Construct: ORF TRCN0000489803
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021120.1_s317c1
- DNA Barcode:
- CCCATGGAGTTTCCAGTACTACTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TAS2R31 (259290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489803
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 259290 | TAS2R31 | taste 2 receptor member 31 | NM_176885.2 | 100% | 100% | |
2 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | NM_176884.2 | 94.7% | 89.3% | (many diffs) |
3 | human | 259292 | TAS2R46 | taste 2 receptor member 46 | NM_176887.2 | 92.4% | 85.1% | (many diffs) |
4 | human | 259291 | TAS2R45 | taste 2 receptor member 45 | NM_176886.2 | 89.3% | 81.5% | (many diffs) |
5 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | XM_003960991.5 | 89.3% | 81.5% | (many diffs) |
6 | human | 259293 | TAS2R30 | taste 2 receptor member 30 | NM_001097643.1 | 88.9% | 77.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 999
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacaact tttataccca tcattttttc cagtgtggta gtggttctat 121 ttgttattgg aaattttgct aatggcttca tagcattggt aaattccatt gagcgggtca 181 agagacaaaa gatctctttt gctgaccaga ttctcactgc tctggcggtc tccagagttg 241 gtttgctctg ggtattatta ttaaattggt attcaactgt gtttaatcca gctttttata 301 gtgtagaagt aagaactact gcttataatg tctgggcagt aaccggccat ttcagcaact 361 ggcttgctac tagcctcagc atattttatt tgctcaagat tgccaatttc tccaacctta 421 tttttcttca cttaaagagg agagttaaga gtgtcattct ggtgatgctg ttggggcctt 481 tactattttt ggcttgtcaa ctttttgtga taaacatgaa agagattgta cggacaaaag 541 aatatgaagg aaacttgact tggaagatca aattgaggag tgcagtgtac ctttcagatg 601 cgactGTAAC CACGCTAGGA AACTTAGTGC CCTTCACTCT GACCCTGCTA TGTTTTTTGC 661 TGTTAATCTG TTCTCTGTGT AAACATCTCA AGAAGATGCA GCTCCATGGT AAAGGATCTC 721 AAGATCCCAG CACCAAGGTC CACATAAAAG CTTTGCAAAC TGTGATCTTT TTCCTCTTGT 781 TATGTGCCGT TTACTTTCTG TCCATAATGA TATCAGTTTG GAGTTTTGGG AGTCTGGAAA 841 ACAAACCTGT CTTCATGTTC TGCAAAGCTA TTAGATTCAG CTATCCTTCA ATCCACCCAT 901 TCATCCTGAT TTGGGGAAAC AAGAAGCTAA AGCAGACTTT TCTTTCAGTT TTGCGGCAAG 961 TGAGGTACTG GGTGAAAGGA GAGAAGCCTT CATCTCCATA GGACCCAGCT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGACCC ATGGAGTTTC CAGTACTACT AACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t