Construct: ORF TRCN0000489804
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020989.1_s317c1
- DNA Barcode:
- TCCCAATTGCAGGTTATGTTCAGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MC2R (4158)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489804
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4158 | MC2R | melanocortin 2 receptor | NM_000529.2 | 100% | 100% | |
| 2 | human | 4158 | MC2R | melanocortin 2 receptor | NM_001291911.1 | 100% | 100% | |
| 3 | human | 4158 | MC2R | melanocortin 2 receptor | XM_017025781.1 | 100% | 100% | |
| 4 | mouse | 17200 | Mc2r | melanocortin 2 receptor | NM_001271716.1 | 84.1% | 88.5% | (many diffs) |
| 5 | mouse | 17200 | Mc2r | melanocortin 2 receptor | NM_001271717.1 | 84.1% | 88.5% | (many diffs) |
| 6 | mouse | 17200 | Mc2r | melanocortin 2 receptor | NM_001301372.1 | 84.1% | 88.5% | (many diffs) |
| 7 | mouse | 17200 | Mc2r | melanocortin 2 receptor | NM_008560.3 | 84.1% | 88.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 963
- ORF length:
- 891
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaagcac attatcaact cgtatgaaaa catcaacaac acagcaagaa 121 ataattccga ctgtcctcgt gtggttttgc cggaggagat atttttcaca atttccattg 181 ttggagtttt ggagaatctg atcgtcctgc tggctgtgtt caagaataag aatctccagg 241 cacccatgta ctttttcatc tgtagcttgg ccatatctga tatgctgggc agcctatata 301 agatcttgga aaatatcctg atcatattga gaaacatggg ctatctcaag ccacgtggca 361 gttttgaaac cacagccgat gacatcatcg actccctgtt tgtcctctcc ctgcttggct 421 ccatcttcag cctgtctgtg attgctgcgg accgctacat caccatcttc cacgcactgc 481 ggtaccacag catcgtgacc atgcgccgca ctgtggtggt gcttacggtc atctggacgt 541 tctgcacggg gactGGCATC ACCATGGTGA TCTTCTCCCA TCATGTGCCC ACAGTGATCA 601 CCTTCACGTC GCTGTTCCCG CTGATGCTGG TCTTCATCCT GTGCCTCTAT GTGCACATGT 661 TCCTGCTGGC TCGATCCCAC ACCAGGAAGA TCTCCACCCT CCCCAGAGCC AACATGAAAG 721 GGGCCATCAC ACTGACCATC CTGCTCGGGG TCTTCATCTT CTGCTGGGCC CCCTTTGTGC 781 TTCATGTCCT CTTGATGACA TTCTGCCCAA GTAACCCCTA CTGCGCCTGC TACATGTCTC 841 TCTTCCAGGT GAACGGCATG TTGATCATGT GCAATGCCGT CATTGACCCC TTCATATATG 901 CCTTCCGGAG CCCAGAGCTC AGGGACGCAT TCAAAAAGAT GATCTTCTGC AGCAGGTACT 961 GGTAGAACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1021 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1081 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCCCAATTG CAGGTTATGT TCAGAACGCG 1141 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt