Transcript: Mouse NM_001271717.1

Mus musculus melanocortin 2 receptor (Mc2r), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mc2r (17200)
Length:
1608
CDS:
287..1177

Additional Resources:

NCBI RefSeq record:
NM_001271717.1
NBCI Gene record:
Mc2r (17200)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420820 CAACCGGTATTAGTAGAATTT pLKO_005 1165 CDS 100% 13.200 18.480 N Mc2r n/a
2 TRCN0000026265 CCTAACAATTATCTGGATGTT pLKO.1 736 CDS 100% 4.950 6.930 N Mc2r n/a
3 TRCN0000026287 CCGCAAGAAATAACTCCGATT pLKO.1 327 CDS 100% 4.050 5.670 N Mc2r n/a
4 TRCN0000026315 CCCTGCTTTGAGTGTTGTAAA pLKO.1 1191 3UTR 100% 13.200 9.240 N Mc2r n/a
5 TRCN0000433477 TCATCTGCAGTTTGGCCATTT pLKO_005 471 CDS 100% 10.800 7.560 N Mc2r n/a
6 TRCN0000417143 GTCATTGCAGCTGACCGTTAC pLKO_005 653 CDS 100% 6.000 4.200 N Mc2r n/a
7 TRCN0000026305 GCCCTGCAATACCATAGCATT pLKO.1 689 CDS 100% 4.950 3.465 N Mc2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00982 pDONR223 100% 84.1% 88.5% None (many diffs) n/a
2 ccsbBroad304_00982 pLX_304 0% 84.1% 88.5% V5 (many diffs) n/a
3 TRCN0000474224 ACCCTTCCCATATCTTATGAACCT pLX_317 55% 84.1% 88.5% V5 (many diffs) n/a
4 TRCN0000489804 TCCCAATTGCAGGTTATGTTCAGA pLX_317 45.8% 84.1% 88.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492159 GCCAAATGTCGGTCCTCTCTTATA pLX_317 40.5% 84% 88.2% V5 (many diffs) n/a
Download CSV