Construct: ORF TRCN0000489904
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021646.1_s317c1
- DNA Barcode:
- GTATATCTGTAGCTGACCAATTTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- LIPG (9388)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489904
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9388 | LIPG | lipase G, endothelial type | NM_006033.4 | 100% | 100% | |
| 2 | human | 9388 | LIPG | lipase G, endothelial type | XM_005258390.1 | 89.3% | 86.4% | (many diffs) |
| 3 | human | 9388 | LIPG | lipase G, endothelial type | NM_001308006.2 | 85.2% | 85% | 571_572ins222 |
| 4 | human | 9388 | LIPG | lipase G, endothelial type | XM_011526267.1 | 84% | 84% | 0_1ins240 |
| 5 | human | 9388 | LIPG | lipase G, endothelial type | XM_011526265.3 | 75.7% | 72.7% | (many diffs) |
| 6 | human | 9388 | LIPG | lipase G, endothelial type | XM_017026095.1 | 60.6% | 60.6% | 0_1ins591 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1569
- ORF length:
- 1500
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gagcaactcc gttcctctgc tctgtttctg gagcctctgc tattgctttg 121 ctgcggggag ccccgtacct tttggtccag agggacggct ggaagataag ctccacaaac 181 ccaaagctac acagactgag gtcaaaccat ctgtgaggtt taacctccgc acctccaagg 241 acccagagca tgaaggatgc tacctctccg tcggccacag ccagccctta gaagactgca 301 gtttcaacat gacagctaaa acctttttca tcattcacgg atggacgatg agcggtatct 361 ttgaaaactg gctgcacaaa ctcgtgtcag ccctgcacac aagagagaaa gacgccaatg 421 tagttgtggt tgactggctc cccctggccc accagcttta cacggatgcg gtcaataata 481 ccagggtggt gggacacagc attgccagga tgctcgactg gctgcaggag aaggacgatt 541 tttctctcgg gaatgtccac ttgatcggct acagcctcgg agcgcacgtg gccgggtatg 601 caggcaactt cgtgaaagga acggtgggcc gaatcacagg tttggatcct gccgggccca 661 tgtttgaagg ggccgacatc cacaagaggc tctctccgga cgatgcagat tttgtggatg 721 tcctccacac ctacacgcgt tccttcggct tgagcattgg tattcagatg cctgtgggcc 781 acattgacat ctaccccaat gggggtgact tccagccagg ctgtggactc aacgatgtct 841 tgggatcaat tgcatatgga acaatcacag aggtggtaaa atgtgagcat gagcgagccg 901 tccacctctt tgttgactct ctggtgaatc aggacaagcc gagttttgcc ttccagtgca 961 ctgactccaa tcgcttcaaa aaggggatct gtctgagctg ccgcaagaac cgttgtaata 1021 gcattggcta caatgccaag aaaatgagga acaagaggaa cagcaaaatg tacctaaaaa 1081 cccgggcagg catgcctttc agagtttacc attatcagat gaaaatccat gtcttcagtt 1141 acaagaacat gggagaaatt gagcccacct tttacgtcaC CCTTTATGGC ACTAATGCAG 1201 ATTCCCAGAC TCTGCCACTG GAAATAGTGG AGCGGATCGA GCAGAATGCC ACCAACACCT 1261 TCCTGGTCTA CACCGAGGAG GACTTGGGAG ACCTCTTGAA GATCCAGCTC ACCTGGGAGG 1321 GGGCCTCTCA GTCTTGGTAC AACCTGTGGA AGGAGTTTCG CAGCTACCTG TCTCAACCCC 1381 GCAACCCCGG ACGGGAGCTG AATATCAGGC GCATCCGGGT GAAGTCTGGG GAAACCCAGC 1441 GGAAACTGAC ATTTTGTACA GAAGACCCTG AGAACACCAG CATATCCCCA GGCCGGGAGC 1501 TCTGGTTTCG CAAGTGTCGG GATGGCTGGA GGATGAAAAA CGAAACCAGT CCCACTGTGG 1561 AGCTTCCCTG AGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1621 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1681 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGTA TATCTGTAGC TGACCAATTT 1741 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t