Transcript: Human NM_001308006.2

Homo sapiens lipase G, endothelial type (LIPG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
LIPG (9388)
Length:
10196
CDS:
253..1533

Additional Resources:

NCBI RefSeq record:
NM_001308006.2
NBCI Gene record:
LIPG (9388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050897 GCCGCAAGAACCGTTGTAATA pLKO.1 962 CDS 100% 13.200 18.480 N LIPG n/a
2 TRCN0000050893 CCGTTGTAATAGCATTGGCTA pLKO.1 972 CDS 100% 2.640 3.696 N LIPG n/a
3 TRCN0000372783 TTACACGGATGCGGTCAATAA pLKO_005 642 CDS 100% 13.200 9.240 N LIPG n/a
4 TRCN0000378899 ATGCAGGCAACTTCGTGAAAG pLKO_005 782 CDS 100% 10.800 7.560 N LIPG n/a
5 TRCN0000050894 CGTCACCCTTTATGGCACTAA pLKO.1 1137 CDS 100% 4.950 3.465 N LIPG n/a
6 TRCN0000050895 GCCCTTAGAAGACTGCAGTTT pLKO.1 468 CDS 100% 4.950 3.465 N LIPG n/a
7 TRCN0000139739 CCTTCTGAGTAGCTGGGATTA pLKO.1 4061 3UTR 100% 10.800 5.400 Y INAVA n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7382 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7382 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5366 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 5330 3UTR 100% 4.950 2.475 Y LINC00336 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7380 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7380 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7380 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489904 GTATATCTGTAGCTGACCAATTTT pLX_317 26.4% 85.2% 85% V5 (not translated due to prior stop codon) 571_572ins222 n/a
2 TRCN0000489198 ACCCGCAAAGAGTCATTTGTATAC pLX_317 18.7% 85.1% 84.8% V5 571_572ins222;1278_1279insG n/a
3 ccsbBroadEn_07405 pDONR223 100% 85.1% 84.8% None 571_572ins222;1205G>A n/a
4 ccsbBroad304_07405 pLX_304 0% 85.1% 84.8% V5 571_572ins222;1205G>A n/a
5 TRCN0000468328 ATGCATCTAATTTGCCTCGTGCAC pLX_317 26.7% 85% 84.6% V5 571_572ins222;922C>A;1205G>A n/a
Download CSV