Construct: ORF TRCN0000489938
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019605.1_s317c1
- DNA Barcode:
- CGAGAATGTGCGATCGATATATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CXCR2 (3579)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489938
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001168298.2 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 2 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001557.4 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 3 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_005246530.3 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 4 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003990.1 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 5 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003991.1 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 6 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003992.1 | 99.7% | 99.4% | 786C>T;889G>A;1080_1081insG |
| 7 | human | 3577 | CXCR1 | C-X-C motif chemokine recep... | NM_000634.3 | 81.4% | 74.7% | (many diffs) |
| 8 | human | 3580 | CXCR2P1 | C-X-C motif chemokine recep... | NR_002712.1 | 37.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1158
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggaa gattttaaca tggagagtga cagctttgaa gatttctgga 121 aaggtgaaga tcttagtaat tacagttaca gctctaccct gccccctttt ctactagatg 181 ccgccccatg tgaaccagaa tccctggaaa tcaacaagta ttttgtggtc attatctatg 241 ccctggtatt cctgctgagc ctgctgggaa actccctcgt gatgctggtc atcttataca 301 gcagggtcgg ccgctccgtc actgatgtct acctgctgaa cctagccttg gccgacctac 361 tctttgccct gaccttgccc atctgggccg cctccaaggt gaatggctgg atttttggca 421 cattcctgtg caaggtggtc tcactcctga aggaagtcaa cttctatagt ggcatcctgc 481 tactggcctg catcagtgtg gaccgttacc tggccattgt ccatgccaca cgcacactga 541 cccagaagcg ctacttggtc aaattcatat gtctcagcat ctggggtctg tccttgctcc 601 tggccctgcc tgtcttactt ttccgaagga ccgtctactc atccaatgtt agcccagcct 661 gctatgagga catgggcaaC AATACAGCAA ACTGGCGGAT GCTGTTACGG ATCCTGCCCC 721 AGTCCTTTGG CTTCATCGTG CCACTGCTGA TCATGCTGTT CTGCTACGGA TTCACCCTGC 781 GTACGCTGTT TAAGGCCCAC ATGGGGCAGA AGCACCGGGC CATGCGGGTC ATCTTTGCTG 841 TCGTCCTCAT CTTCCTGCTT TGCTGGCTGC CCTACAACCT GGTCCTGCTG GCAGACACCC 901 TCATGAGGAC CCAGGTGATC CAGGAGACCT GTGAGCGCCG CAATCACATC GACCGGGCTC 961 TGAATGCCAC CGAGATTCTG GGCATCCTTC ACAGCTGCCT CAACCCCCTC ATCTACGCCT 1021 TCATTGGCCA GAAGTTTCGC CATGGACTCC TCAAGATTCT AGCTATACAT GGCTTGATCA 1081 GCAAGGACTC CCTGCCCAAA GACAGCAGGC CTTCCTTTGT TGGCTCTTCT TCAGGGCACA 1141 CTTCCACTAC TCTCGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CGAGAATGTG CGATCGATAT 1321 ATTAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt