Construct: ORF TRCN0000491329
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016013.2_s317c1
- Derived from:
- ccsbBroadEn_11592
- DNA Barcode:
- GCGCCTGTACCGTTCACTCAATGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPACA9 (11092)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491329
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11092 | SPACA9 | sperm acrosome associated 9 | NM_001316897.2 | 100% | 100% | |
2 | human | 11092 | SPACA9 | sperm acrosome associated 9 | NM_001316898.2 | 100% | 100% | |
3 | human | 11092 | SPACA9 | sperm acrosome associated 9 | XM_024447396.1 | 100% | 100% | |
4 | human | 11092 | SPACA9 | sperm acrosome associated 9 | XM_017014231.1 | 80.8% | 71.1% | (many diffs) |
5 | human | 11092 | SPACA9 | sperm acrosome associated 9 | NM_018956.5 | 75.3% | 74.3% | (many diffs) |
6 | human | 11092 | SPACA9 | sperm acrosome associated 9 | XM_024447397.1 | 75.3% | 74.3% | (many diffs) |
7 | human | 11092 | SPACA9 | sperm acrosome associated 9 | NM_001316900.2 | 72.6% | 72.5% | 485G>T;487_490delACGA;492_493ins178 |
8 | human | 11092 | SPACA9 | sperm acrosome associated 9 | NR_133631.2 | 20.8% | 1_130del;274_275ins203;594_2015del | |
9 | mouse | 69987 | Spaca9 | sperm acrosome associated 9 | NM_027283.1 | 65.4% | 67.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgaggtgaaa gaatcccttc gcagcatcga gcagaagtac aagctcttcc 121 agcagcagca gctcaccttc accgccgctc tggagcactg cagggagaac gcccacgaca 181 agatccggcc catctccagc attggacagg tgcagagcta catggaacac tactgcaaca 241 gctccacaga ccggcgggtt ctgctcatgt tcctggacat ctgttcagag ctgaataagc 301 tctgccagca ctttgaggcc gtgcactctg gcaccccagt caccaacaac ctcctggaga 361 aatgcaaaac cctcgttagc caaagcaacg acttaagcag cctcagagca aaataccctc 421 atgatgtggt gaaccaccTC AGCTGTGACG AGGCCCGGAA CCACTACGGC GGCGTGGTCA 481 GCCTCATCCC CCTCATCCTA GACTTAATGA AAGAATGGAT CGCCCACTCC GAGAAGTTGC 541 CGCGCAAGGT GCTGCAGCAC GTGAGTGAGC CCCAGGCGCA CCAGGAGAGC ACCAGGGGAG 601 CCGCTCGTCC TGCCCAGGCC ATAGGGACCC AGCCCAGGGC CACTAAACAC AAGTGTAGAC 661 AGCTCACAAA AGCCAGCCTC AAACCCAGGG GATGTTCAAA ACCACCCTGG AGGCCTCCTG 721 GTGGGAAATT GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 781 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 841 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGCG CCTGTACCGT TCACTCAATG 901 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t