Transcript: Human XM_024447397.1

PREDICTED: Homo sapiens sperm acrosome associated 9 (SPACA9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPACA9 (11092)
Length:
727
CDS:
155..661

Additional Resources:

NCBI RefSeq record:
XM_024447397.1
NBCI Gene record:
SPACA9 (11092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263685 TTAGCCAAAGCAACGACTTAA pLKO_005 465 CDS 100% 13.200 18.480 N SPACA9 n/a
2 TRCN0000263688 ATCTGTTCAGAGCTGAATAAG pLKO_005 368 CDS 100% 13.200 9.240 N SPACA9 n/a
3 TRCN0000263687 CCAACAACCTCCTGGAGAAAT pLKO_005 432 CDS 100% 13.200 9.240 N SPACA9 n/a
4 TRCN0000263689 AGAGCTACATGGAACACTACT pLKO_005 303 CDS 100% 4.950 3.465 N SPACA9 n/a
5 TRCN0000263686 AGCATCGAGCAGAAGTACAAG pLKO_005 182 CDS 100% 4.950 3.465 N SPACA9 n/a
6 TRCN0000172756 CAGAGCTACATGGAACACTAC pLKO.1 302 CDS 100% 4.050 2.835 N SPACA9 n/a
7 TRCN0000173067 CGAGCAGAAGTACAAGCTCTT pLKO.1 187 CDS 100% 4.050 2.835 N SPACA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11592 pDONR223 100% 75.3% 74.3% None (many diffs) n/a
2 ccsbBroad304_11592 pLX_304 0% 75.3% 74.3% V5 (many diffs) n/a
3 TRCN0000491329 GCGCCTGTACCGTTCACTCAATGT pLX_317 44.3% 75.3% 74.3% V5 (many diffs) n/a
Download CSV