Construct: ORF TRCN0000491336
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007647.1_s317c1
- Derived from:
- ccsbBroadEn_13271
- DNA Barcode:
- TTTCTCGGACTGAAACCGATAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLB1 (151056)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491336
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151056 | PLB1 | phospholipase B1 | XM_011532609.2 | 47.4% | 47.4% | 1_1401del;1852G>T |
| 2 | human | 151056 | PLB1 | phospholipase B1 | XM_011532610.2 | 47.4% | 47.4% | 1_1401del;1852G>T |
| 3 | human | 151056 | PLB1 | phospholipase B1 | XM_011532602.2 | 36.8% | 36.8% | 1_2169del;2620G>T |
| 4 | human | 151056 | PLB1 | phospholipase B1 | XM_011532603.2 | 36.8% | 36.8% | 1_2169del;2620G>T |
| 5 | human | 151056 | PLB1 | phospholipase B1 | XM_011532601.3 | 36.3% | 36.2% | 1_2220del;2671G>T |
| 6 | human | 151056 | PLB1 | phospholipase B1 | XM_011532593.2 | 29.8% | 29.7% | 1_2985del;3436G>T |
| 7 | human | 151056 | PLB1 | phospholipase B1 | NM_001170585.1 | 29.2% | 29.1% | 1_3072del;3523G>T |
| 8 | human | 151056 | PLB1 | phospholipase B1 | NR_138141.1 | 29.1% | 1_2011del;2462G>T;3281_4357del | |
| 9 | human | 151056 | PLB1 | phospholipase B1 | NM_153021.5 | 28.9% | 28.9% | 1_3105del;3556G>T |
| 10 | human | 151056 | PLB1 | phospholipase B1 | XM_017003433.2 | 28.9% | 28.9% | 1_3105del;3556G>T |
| 11 | human | 151056 | PLB1 | phospholipase B1 | XM_011532581.3 | 28.8% | 28.7% | 1_3132del;3583G>T |
| 12 | human | 151056 | PLB1 | phospholipase B1 | XM_017003432.2 | 28.7% | 28.7% | 1_3138del;3589G>T |
| 13 | human | 151056 | PLB1 | phospholipase B1 | XM_011532589.2 | 28.5% | 28.5% | 1_3165del;3616G>T |
| 14 | human | 151056 | PLB1 | phospholipase B1 | XM_011532579.2 | 28% | 21.8% | (many diffs) |
| 15 | human | 151056 | PLB1 | phospholipase B1 | XM_011532584.3 | 24.3% | 23% | (many diffs) |
| 16 | human | 151056 | PLB1 | phospholipase B1 | XM_011532588.2 | 23.1% | 20.9% | (many diffs) |
| 17 | human | 151056 | PLB1 | phospholipase B1 | XM_011532591.3 | 23% | 22.5% | (many diffs) |
| 18 | human | 151056 | PLB1 | phospholipase B1 | XM_011532590.2 | 22.9% | 21% | (many diffs) |
| 19 | human | 151056 | PLB1 | phospholipase B1 | XR_001738646.2 | 22.3% | (many diffs) | |
| 20 | human | 151056 | PLB1 | phospholipase B1 | XR_939663.3 | 20.8% | (many diffs) | |
| 21 | human | 151056 | PLB1 | phospholipase B1 | XM_017003434.1 | 18.7% | 18.3% | (many diffs) |
| 22 | human | 151056 | PLB1 | phospholipase B1 | XR_001738647.2 | 13.8% | 1_3192del;3643G>T;3813_3814ins648 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1335
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc catcacctgt cccactcaga atgagccctt cctgagaacc cctcggaata 121 gtaactacac gtaccccatc aagccagcca ttgagaactg gggcagtgac ttcctgtgta 181 cagagtggaa ggcttccaat agtgttccaa cctctgtcca ccagctccga ccagcagaca 241 tcaaagtggt ggccgccctg ggtgactctc tgactacagc agtgggagct cgaccaaaca 301 actccagtga cctacccaca tcttggaggg gactctcttg gagcattgga ggggatggga 361 acttggagac tcacaccaca ctgcccaaca ttctgaagaa gttcaaccct tacctccttg 421 gcttctctac cagcacctgg gaggggacag caggactaaa tgtggcagcg gaaggggcca 481 gagctaggga catgccagcc caggcctggg acctgttaga gcgaatgaaa aacagccccg 541 acatcaacct ggagaaagac tggaagctgg tcacactctt cattggggtc aacgacttgt 601 gtcattactg tgagaatccg gaggcccact tggccacgga atatgttcag cacatccaac 661 aggccctgga catcctctct gaggagctcc caagggcttt cgtcaacgtg gtggaggtca 721 tggagctggc tagcctgtac cagggccaag gcgggaaatg tgccatgctg gcagctcaga 781 acaactgcac ttgcctcaga cactcgcaaa gctccctgga gaagcaagaa ctgaagaaag 841 tgaactggaa cctccagcat ggcatctcca gtttctccta ctggcaccaa tacacacagc 901 gtgaggactt tgcggttgtg gtgcagcctt tcttccaaaa cacactcacc ccactgaacg 961 agagagggga cactgacctc accttcttct ccgaggactg ttttcacttc tcagaccgcg 1021 ggcatgccga gatggccatc gcactctgga acaacatgct ggaaccagtg ggccgcaaga 1081 ctaccTCCAA CAACTTCACC CACAGCCGAG CCAAACTCAA GTGCCCCTCT CCTGAGAGCC 1141 CTTACCTCTA CACCCTGCGG AACAGCCGAT TGCTCCCAGA CCAGGCTGAA GAAGCCCCCG 1201 AGGTGCTCTA CTGGGCTGTC CCAGTGGCAG CGGGAGTCGG CCTTGTGGTG GGCATCATCG 1261 GGACAGTGGT CTGGAGGTGC AGGAGAGGTG GCCGGAGGGA AGATCCTCCA ATGAGCCTGC 1321 GCACTGTGGC CCTCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1381 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1441 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TTTCTCGGAC TGAAACCGAT 1501 AAGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt