Construct: ORF TRCN0000491427
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016128.1_s317c1
- Derived from:
- ccsbBroadEn_00110
- DNA Barcode:
- AATCAAATTGAGCATCATCACTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ASGR2 (433)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491427
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | NM_080913.3 | 100% | 100% | |
| 2 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_005256648.2 | 100% | 100% | |
| 3 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_006721526.2 | 100% | 100% | |
| 4 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | NM_080914.2 | 98.2% | 98.2% | 185_199del |
| 5 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_017024651.1 | 98.2% | 98.2% | 185_199del |
| 6 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_011523863.3 | 95.9% | 95.9% | 185_220del |
| 7 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_011523865.2 | 95.9% | 95.9% | 185_220del |
| 8 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_011523866.1 | 95.9% | 95.9% | 185_220del |
| 9 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | NM_001201352.1 | 93.7% | 93.7% | 65_121del |
| 10 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_024450756.1 | 93.7% | 93.7% | 65_121del |
| 11 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | NM_001181.4 | 92.2% | 92.2% | 65_121del;242_256del |
| 12 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | NM_080912.3 | 92.2% | 92.2% | 65_121del;242_256del |
| 13 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_017024652.2 | 92.2% | 92.2% | 65_121del;242_256del |
| 14 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_017024653.2 | 92.2% | 92.2% | 65_121del;242_256del |
| 15 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_011523864.3 | 90.2% | 90.2% | 65_121del;242_277del |
| 16 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_006721524.2 | 86.4% | 86.4% | 67_68ins117 |
| 17 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_024450757.1 | 86.4% | 86.4% | 67_68ins117 |
| 18 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_024450755.1 | 75.7% | 75.7% | 1_276del |
| 19 | human | 433 | ASGR2 | asialoglycoprotein receptor 2 | XM_011523862.3 | 70% | 70% | 1_276del;341_397del;518_553del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 927
- ORF length:
- 861
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc caaggacttt caagatatcc agcagctgag ctcggaggaa aatgaccatc 121 ctttccatca agggccacct cctgcccagc ccctggcaca gcgtctctgc tccatggtct 181 gcttcagtct gcttgccctg agcttcaaca tcctgctgct ggtggtcatc tgtgtgactg 241 ggtcccaaag tgcacagctg caagccgagc tgcggagcct gaaggaagct ttcagcaact 301 tctcctcgag caccctgacg gaggtccagg caatcagcac ccacggaggc agcgtgggtg 361 acaagatcac atccctagga gccaagctgg agaaacagca gcaggacctg aaagcagatc 421 acgatgccct gctcttccat ctgaagcact tccccgtgga cctgcgcttc gtggcctgcc 481 agatggagct cctccacagc aacggctccc aaaggacctg ctgccccgtc aactgggtgg 541 agcaccaagg cagctgctac tggttctctc actccgggaa ggcctgggct gaggcggaga 601 agtactgcca gctggagaac gcacacctgg tggtcatcaa ctcctgggag gagcagaaat 661 tcattgtaca acacacgaac cccttcaata cctGGATAGG TCTCACGGAC AGTGATGGCT 721 CTTGGAAATG GGTGGATGGC ACAGACTATA GGCACAACTA CAAGAACTGG GCTGTCACTC 781 AGCCAGATAA TTGGCACGGG CACGAGCTGG GTGGAAGTGA AGACTGTGTT GAAGTCCAGC 841 CGGATGGCCG CTGGAACGAT GACTTCTGCC TGCAGGTGTA CCGCTGGGTG TGTGAGAAAA 901 GGCGGAATGC CACCGGCGAG GTGGCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAATCAAAT 1081 TGAGCATCAT CACTTAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt