Transcript: Human XM_006721524.2

PREDICTED: Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASGR2 (433)
Length:
1261
CDS:
262..1008

Additional Resources:

NCBI RefSeq record:
XM_006721524.2
NBCI Gene record:
ASGR2 (433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431432 TGGCTTCTCTGTTGAGGATTT pLKO_005 1055 3UTR 100% 10.800 7.560 N ASGR2 n/a
2 TRCN0000437197 ACACCTCTGGCTAACCCATAC pLKO_005 1016 3UTR 100% 6.000 4.200 N ASGR2 n/a
3 TRCN0000061509 GAGGAGCAGAAATTCATTGTA pLKO.1 727 CDS 100% 5.625 3.938 N ASGR2 n/a
4 TRCN0000426681 ACTATAGGCACAACTACAAGA pLKO_005 824 CDS 100% 4.950 3.465 N ASGR2 n/a
5 TRCN0000061508 GCTCTTCCATCTGAAGCACTT pLKO.1 510 CDS 100% 4.050 2.835 N ASGR2 n/a
6 TRCN0000061512 CCTGAAGGAAGCTTTCAGCAA pLKO.1 357 CDS 100% 0.264 0.185 N ASGR2 n/a
7 TRCN0000061511 CTGTCACTCAGCCAGATAATT pLKO.1 851 CDS 100% 15.000 9.000 N ASGR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00110 pDONR223 100% 86.4% 86.4% None 67_68ins117 n/a
2 ccsbBroad304_00110 pLX_304 0% 86.4% 86.4% V5 67_68ins117 n/a
3 TRCN0000491427 AATCAAATTGAGCATCATCACTTA pLX_317 27.6% 86.4% 86.4% V5 67_68ins117 n/a
Download CSV