Construct: ORF TRCN0000491567
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020016.2_s317c1
- DNA Barcode:
- TACAACGACCACTGGCGCCTAGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIPC (3990)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491567
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3990 | LIPC | lipase C, hepatic type | NM_000236.3 | 99.6% | 99.6% | (many diffs) |
| 2 | human | 3990 | LIPC | lipase C, hepatic type | XM_005254372.1 | 99.6% | 99.6% | (many diffs) |
| 3 | human | 3990 | LIPC | lipase C, hepatic type | XM_024449916.1 | 99.6% | 99.6% | (many diffs) |
| 4 | human | 3990 | LIPC | lipase C, hepatic type | XM_024449917.1 | 99.6% | 99.6% | (many diffs) |
| 5 | human | 3990 | LIPC | lipase C, hepatic type | XM_005254374.4 | 93.6% | 92.1% | (many diffs) |
| 6 | human | 3990 | LIPC | lipase C, hepatic type | XM_006720502.4 | 90.2% | 90.2% | (many diffs) |
| 7 | human | 3990 | LIPC | lipase C, hepatic type | XM_017022176.1 | 69.5% | 64.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1569
- ORF length:
- 1500
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggacacaagt cccctgtgtt tctccattct gttggtttta tgcatcttta 121 tccaatcaag tgcccttgga caaagcctga aaccagagcc atttggaaga agagctcaag 181 ctgttgaaac aaacaaaacg ctgcatgaga tgaagaccag attcctgctc tttggagaaa 241 ccaatcaggg ctgtcagatt cgaatcaatc atccggacac gttacaggag tgcggcttca 301 actcctccct gcctctggtg atgataatcc acgggtggtc ggtggacggc gtgctagaaa 361 actggatctg gcagatggtg gccgcgctga agtctcagcc ggcccagcca gtgaacgtgg 421 ggctggtgga ctggatcacc ctggcccacg accactacac catcgccgtc cgcaacaccc 481 gccttgtggg caaggaggtc gcggctcttc tccggtggct ggaggaatct gtgcaactct 541 ctcgaagcca tgttcaccta attgggtaca gcctgggtgc acacgtgtca ggatttgccg 601 gcagttccat cggtggaacg cacaagattg ggagaatcac agggctggat gccgcgggac 661 ctttgtttga gggaagcgcc cccagcaatc gtctttctcc agatgatgcc aattttgtgg 721 atgccattca tacctttacg cgggagcaca tgggcctgag cgtgggcatc aaacagccca 781 taggacacta tgacttctat cccaacgggg gctccttcca gcctggctgc cacttcctag 841 agctctacag acatattgcc cagcacggct tcaatgccat cacccagacc ataaaatgct 901 cccacgagcg atcggtgcac cttttcatcg actccttgct gcacgccggc acgcagagca 961 tggcctaccc gtgtggtgac atgaacagct tcagccaggg cctgtgcctg agctgcaaga 1021 agggccgctg caacacgctg ggctaccacg tccgccagga gccgcggagc aagagcaaga 1081 ggctcttcct cgtaacgcga gcccagtccc ccttcaaagt ttatcattac cagttaaaga 1141 tccagttcat caaccaaact gagacgccaa tacaaacaac ttttaccatg tcactactcg 1201 gaacaaaaga gaaaatgcag aaaattccca tcactctggg caaaggaatt gctagtaata 1261 aaacgtattc ctttcttatc acgctGGATG TGGATATCGG CGAGCTGATC ATGATCAAGT 1321 TCAAGTGGGA AAACAGTGCA GTGTGGGCCA ATGTCTGGGA CACGGTCCAG ACCATCATCC 1381 CATGGAGCAC AGGGCCGCGC CACTCAGGCC TCGTTCTGAA GACGATCAGA GTCAAAGCAG 1441 GAGAAACCCA GCAAAGAATG ACATTTTGTT CAGAAAACAC AGATGACCTA CTACTTCGCC 1501 CAACCCAGGA AAAAATCTTC GTGAAATGTG AAATAAAGTC TAAAACATCA AAGCGAAAGA 1561 TCAGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1621 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1681 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATACAACGAC CACTGGCGCC TAGACACGCG 1741 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt