Construct: ORF TRCN0000491587
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020126.2_s317c1
- DNA Barcode:
- GAAAAGTAACATTCCGAGGGATCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- RAF1 (5894)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491587
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354690.2 | 100% | 100% | |
| 2 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_002880.3 | 100% | 100% | |
| 3 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XM_011533974.3 | 100% | 100% | |
| 4 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354689.3 | 97% | 97% | 835_894del |
| 5 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354693.2 | 94.9% | 94.7% | 581_582ins99 |
| 6 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XM_017006966.1 | 94.9% | 94.7% | 581_582ins99 |
| 7 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354691.2 | 87.5% | 83.9% | 0_1ins130;76_77ins113 |
| 8 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354692.2 | 87.5% | 83.9% | 0_1ins130;76_77ins113 |
| 9 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354694.2 | 84.8% | 81.4% | 0_1ins130;76_77ins113;592_651del |
| 10 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354695.2 | 82.4% | 78.7% | 0_1ins130;76_77ins113;338_339ins99 |
| 11 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148942.2 | 60.9% | 1_331del;1321_1322insAG;2274_3182del | |
| 12 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148941.2 | 59.9% | 1_331del;1439_1497del;2335_3243del | |
| 13 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148940.2 | 58.9% | 1_331del;1439_1551del;2389_3297del | |
| 14 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XR_001740227.1 | 48.3% | (many diffs) | |
| 15 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | NM_029780.3 | 90.7% | 97.6% | (many diffs) |
| 16 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505365.2 | 90.7% | 97.6% | (many diffs) |
| 17 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505363.3 | 88% | 94.7% | (many diffs) |
| 18 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505364.2 | 88% | 94.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2016
- ORF length:
- 1944
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagcac atacagggag cttggaagac gatcagcaat ggttttggat 121 tcaaagatgc cgtgtttgat ggctccagct gcatctctcc tacaatagtt cagcagtttg 181 gctatcagcg ccgggcatca gatgatggca aactcacaga tccttctaag acaagcaaca 241 ctatccgtgt tttcttgccg aacaagcaaa gaacagtggt caatgtgcga aatggaatga 301 gcttgcatga ctgccttatg aaagcactca aggtgagggg cctgcaacca gagtgctgtg 361 cagtgttcag acttctccac gaacacaaag gtaaaaaagc acgcttagat tggaatactg 421 atgctgcgtc tttgattgga gaagaacttc aagtagattt cctggatcat gttcccctca 481 caacacacaa ctttgctcgg aagacgttcc tgaagcttgc cttctgtgac atctgtcaga 541 aattcctgct caatggattt cgatgtcaga cttgtggcta caaatttcat gagcactgta 601 gcaccaaagt acctactatg tgtgtggact ggagtaacat cagacaactc ttattgtttc 661 caaattccac tattggtgat agtggagtcc cagcactacc ttctttgact atgcgtcgta 721 tgcgagagtc tgtttccagg atgcctgtta gttctcagca cagatattct acacctcacg 781 ccttcacctt taacacctcc agtccctcat ctgaaggttc cctctcccag aggcagaggt 841 cgacatccac acctaatgtc cacatggtca gcaccaccct gcctgtggac agcaggatga 901 ttgaggatgc aattcgaagt cacagcgaat cagcctcacc ttcagccctg tccagtagcc 961 ccaacaatct gagcccaaca ggctggtcac agccgaaaac ccccgtgcca gcacaaagag 1021 agcgggcacc agtatctggg acccaggaga aaaacaaaat taggcctcgt ggacagagag 1081 attcaagcta ttattgggaa atagaagcca gtgaagtgat gctgtccact cggattgggt 1141 caggctcttt tggaactgtt tataagggta aatggcacgg agatgttgca gtaaagatcc 1201 taaaggttgt cgacccaacc ccagagcaat tccaggcctt caggaatgag gtggctgttc 1261 tgcgcaaaac acggcatgtg aacattctgc ttttcatggg gtacatgaca aaggacaacc 1321 tggcaattgt gacccagtgg tgcgagggca gcagcctcta caaacacctg catgtccagg 1381 agaccaagtt tcagatgttc cagctaattg acattgcccg gcagacggct cagggaatgg 1441 actatttgca tgcaaagaac atcatccata gagacatgaa atccaacaat atatttctcc 1501 atgaaggctt aacagtgaaa attggagatt ttggtttggc aacagtaaag tcacgctgga 1561 gtggttctca gcaggttgaa caacctactg gctctgtcct ctggatggcc ccagaggtga 1621 tccgaatgca ggataacaac ccattcagtt tccagtcgga tgtctactcc tatggcatcg 1681 tattgtatga actgatgacg ggggagcttc cttattctca catcaaCAAC CGAGATCAGA 1741 TCATCTTCAT GGTGGGCCGA GGATATGCCT CCCCAGATCT TAGTAAGCTA TATAAGAACT 1801 GCCCCAAAGC AATGAAGAGG CTGGTAGCTG ACTGTGTGAA GAAAGTAAAG GAAGAGAGGC 1861 CTCTTTTTCC CCAGATCCTG TCTTCCATTG AGCTGCTCCA ACACTCTCTA CCGAAGATCA 1921 ACCGGAGCGC TTCCGAGCCA TCCTTGCATC GGGCAGCCCA CACTGAGGAT ATCAATGCTT 1981 GCACGCTGAC CACGTCCCCG AGGCTGCCTG TCTTCTGAGA CCCAGCTTTC TTGTACAAAG 2041 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 2101 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 2161 ACGAGAAAAG TAACATTCCG AGGGATCTAC GCGTTAAGTC gacaatcaac ctctggatta 2221 caaaatttgt gaaagatt