Construct: ORF TRCN0000491670
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017843.2_s317c1
- Derived from:
- ccsbBroadEn_03411
- DNA Barcode:
- AAAAGGCTAACTTCTCTCATTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UNC93A (54346)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491670
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54346 | UNC93A | unc-93 homolog A | NM_001143947.2 | 100% | 100% | |
2 | human | 54346 | UNC93A | unc-93 homolog A | NM_018974.4 | 90.8% | 90.8% | 499_624del |
3 | human | 54346 | UNC93A | unc-93 homolog A | XM_011535905.2 | 90.8% | 90.8% | 499_624del |
4 | human | 54346 | UNC93A | unc-93 homolog A | XM_011535906.2 | 90.8% | 90.8% | 499_624del |
5 | human | 54346 | UNC93A | unc-93 homolog A | XM_011535907.2 | 90.8% | 90.8% | 499_624del |
6 | human | 54346 | UNC93A | unc-93 homolog A | XM_017010958.1 | 90.8% | 90.8% | 499_624del |
7 | human | 54346 | UNC93A | unc-93 homolog A | XM_011535908.2 | 76.4% | 72.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1314
- ORF length:
- 1245
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggacagaagt ctaaggaacg tccttgtggt ttcctttggg ttcctgcttc 121 tctttacagc ctatggaggt ctgcagagcc tgcagagcag cctgtacagc gaggagggcc 181 tgggtgtcac agcgctcagc accctctatg gaggcatgct cctgtcctcc atgttcctcc 241 caccgctcct catcgagagg ctgggctgca aggggaccat catcctctcc atgtgtggct 301 acgtggcctt ctccgtgggc aacttcttcg ccagctggta cactttgatc cccacctcca 361 tactgctggg actcggggcc gccccgctgt ggtctgcaca gtgcacatac ctcacgatca 421 cgggaaacac acatgcagag aaggcgggaa agcgtggcaa agacatggtg aaccagtatt 481 ttggcatctt cttcctcata ttccagtcat ccggtgtgtg gggcaacttg atctcatcgc 541 tggtatttgg ccagactccc agccaaggga gtggtgtcct ggctgtcctg atgatagctg 601 cgttcctcca acccatacga gatgttcagc gggaaagtga aggagagaag aaatcagtac 661 ctttctggtc cactttactg tcgactttca agctatatag agataaacgt ctgtgcctct 721 taattctgct gccgctgtac agtggattgc agcaaggatt cctctccagc gaatacacaa 781 ggtcctatgt cacctgcacc ctgggcatcc agttcgtcgg ctacgtgatg atctgcttct 841 cggccactga cgcgctgtgc tccgtgttgt atggaaaggt ctcgcagtac acgggcaggg 901 ctgtgctgta cgtgctgggc gcggtgaccc acgtgtcctg catgattgcc ctactgctgt 961 ggagacctcg tgctgaccat ctggcagtgt tcttcgtatt ctctggcctg tggggcgtgg 1021 cagatgccgt ctggcagaca caaaacaatg ctctctacgg cgttctgttt gagaagagca 1081 aggaagctgc cTTCGCCAAT TACCGCCTGT GGGAGGCCCT GGGCTTCGTC ATTGCCTTCG 1141 GGTACAGCAT GTTTTTGTGC GTGCACGTCA AGCTCTACAT TCTGCTGGGG GTCCTGAGCC 1201 TGACCATGGT GGCGTATGGG CTTGTGGAGT GCGTGGAGTC CAAGAACCCG ATCAGACCCC 1261 ACGCTCCAGG ACAGGTCAAC CAGGCAGAGG ATGAAGAAAT ACAAACAAAA ATGTTGCCAA 1321 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1381 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1441 TATCTTGTGG AAAGGACGAA AAAGGCTAAC TTCTCTCATT CAAACGCGTT AAGTCgacaa 1501 tcaacctctg gattacaaaa tttgtgaaag att