Transcript: Human XM_011535907.2

PREDICTED: Homo sapiens unc-93 homolog A (UNC93A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC93A (54346)
Length:
2741
CDS:
806..2179

Additional Resources:

NCBI RefSeq record:
XM_011535907.2
NBCI Gene record:
UNC93A (54346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412551 ATAAACGTCTGTGCCTCTTAA pLKO_005 1566 CDS 100% 13.200 18.480 N UNC93A n/a
2 TRCN0000437225 ACGAGATGTTCAGCGGGAAAG pLKO_005 1480 CDS 100% 6.000 8.400 N UNC93A n/a
3 TRCN0000148552 CGAATACACAAGGTCCTATGT pLKO.1 1633 CDS 100% 4.950 3.960 N UNC93A n/a
4 TRCN0000128163 CCATTCTGAAGAGATCATGTT pLKO.1 2291 3UTR 100% 4.950 3.465 N UNC93A n/a
5 TRCN0000147662 GCCAATTAGAATTTGCCTGAA pLKO.1 2447 3UTR 100% 4.050 2.835 N UNC93A n/a
6 TRCN0000130560 GCAGTGTTCTTCGTATTCTCT pLKO.1 1847 CDS 100% 3.000 2.100 N UNC93A n/a
7 TRCN0000128739 CAGGCAGAGGATGAAGAAATA pLKO.1 2144 CDS 100% 13.200 7.920 N UNC93A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03411 pDONR223 100% 90.8% 90.8% None 499_624del n/a
2 ccsbBroad304_03411 pLX_304 0% 90.8% 90.8% V5 499_624del n/a
3 TRCN0000491670 AAAAGGCTAACTTCTCTCATTCAA pLX_317 18.3% 90.8% 90.8% V5 499_624del n/a
Download CSV