Construct: ORF TRCN0000491726
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021311.2_s317c1
- DNA Barcode:
- ACCTATGCCGTGATTTCATACGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- HVCN1 (84329)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491726
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_001040107.2 | 100% | 100% | |
| 2 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_032369.4 | 100% | 100% | |
| 3 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_005253948.2 | 100% | 100% | |
| 4 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538845.2 | 100% | 100% | |
| 5 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538846.2 | 100% | 100% | |
| 6 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538847.1 | 100% | 100% | |
| 7 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_017020027.1 | 100% | 100% | |
| 8 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_024449225.1 | 100% | 100% | |
| 9 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_001256413.2 | 92.6% | 92.6% | 0_1ins60 |
| 10 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538838.2 | 85.3% | 85.3% | 20_160del |
| 11 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538839.2 | 85.3% | 85.3% | 20_160del |
| 12 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538840.3 | 85.3% | 85.3% | 20_160del |
| 13 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538841.2 | 85.3% | 85.3% | 20_160del |
| 14 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538842.2 | 85.3% | 85.3% | 20_160del |
| 15 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538844.2 | 85.3% | 85.3% | 20_160del |
| 16 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_017020026.2 | 85.3% | 85.3% | 20_160del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 891
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccacc tgggacgaaa aggcagtcac ccgcagggcc aaggtggctc 121 ccgctgagag gatgagcaag ttcttaaggc acttcacggt cgtgggagac gactaccatg 181 cctggaacat caactacaag aaatgggaga atgaagagga ggaggaggag gaggagcagc 241 caccacccac accagtctca ggcgaggaag gcagagctgc agcccctgac gttgcccctg 301 cccctggccc cgcacccagg gccccccttg acttcagggg catgttgagg aaactgttca 361 gctcccacag gtttcaggtc atcatcatct gcttggtggt tctggatgcc ctcctggtgc 421 ttgctgagct catcctggac ctgaagatca tccagcccga caagaataac tatgctgcca 481 tggtattcca ctacatgagc atcaccatct tggtcttttt tatgatggag atcatcttta 541 aattatttgt cttccgcctg gagttctttc accacaagtt tgagatcctg gatGCCGTCG 601 TGGTGGTGGT CTCATTCATC CTCGACATTG TCCTCCTGTT CCAGGAGCAC CAGTTTGAGG 661 CTCTGGGCCT GCTGATTCTG CTCCGGCTGT GGCGGGTGGC CCGGATCATC AATGGGATTA 721 TCATCTCAGT TAAGACACGT TCAGAACGGC AACTCTTAAG GTTAAAACAG ATGAATGTAC 781 AATTGGCCGC CAAGATTCAA CACCTTGAGT TCAGCTGCTC TGAGAAGGAA CAAGAAATTG 841 AAAGACTTAA CAAACTATTG CGACAGCATG GACTTCTTGG TGAAGTGAAC TAGAACCCAG 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAA CCTATGCCGT GATTTCATAC GTTACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att