Construct: ORF TRCN0000491977
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000645.1_s317c1
- Derived from:
- ccsbBroadEn_06497
- DNA Barcode:
- TAGTATGCATTGGACTATTCCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIF25 (3834)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491977
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3834 | KIF25 | kinesin family member 25 | NM_005355.3 | 99.8% | 100% | 321C>T |
| 2 | human | 3834 | KIF25 | kinesin family member 25 | XM_011535803.3 | 99.8% | 100% | 321C>T |
| 3 | human | 3834 | KIF25 | kinesin family member 25 | NM_030615.2 | 86.3% | 86.4% | 321C>T;829_984del |
| 4 | human | 3834 | KIF25 | kinesin family member 25 | XM_011535802.3 | 86.3% | 86.4% | 321C>T;829_984del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1065
- ORF length:
- 996
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacatggacc tcaggtcagc ttcagcgtga gaagcaggcc aggcctgggt 121 ctggagccgt cctggccttc ccagatgaca aggacctcag ggtttatggt ccagcagagt 181 ctcagagcgc ggtctttgga gatgtgtgcc ccctactcac ttctctcttg gatgggtaca 241 atgtttgtgt tatggcgtat ggacagacgg gcagcggaaa gagctatacc atgctgggac 301 gccattcgga cgacggccct gttctgccgc ttgacccaca gagtgactta ggaattatcc 361 ctagagtggc tgaggagctc ttcaggctta ttttggaaaa tacctcaaga agcccaaagg 421 ttgaagtctc catagtggaa gtttacaata atgacatttt tgaccttctg gccaaagaca 481 gcattgcagc agtgtcgggg gtcaagcgtg aggtggtgac agccaaggat ggacggacag 541 aggttgcgct gctggcctct gaggctgtcg gcagcgcctc gaaactgatg gagctcgttc 601 atggaggtct gcagctcagg gcgaagcacc ccaccctggt gcacgcggat tcctccaggt 661 ctcacctgat aattacggtg actctaacca cagcctcctg ctctgacagc actgcagacc 721 aagcctgcag tgccaccctc cccagggagc aaacagaggc aggaagggca ggaaggagcc 781 gcagagcttc tcaaggggcc ttggctccac agctggttcc tgggaacccc gcagggcatg 841 cggagcaggt gcaggctcga ctacagctcg tggactcggc cggcagcgag tgcgttggag 901 gcgatgcgaa gttacTGGTG ATTCTCTGCA TTTCTCCCAG CCAGAGGCAC CTGGCACAGA 961 CGTTGCAGGG CCTGGGTTTC GGGATCCGAG CTCGGCAAGT CCAGCGAGGC CCTGCCCGAA 1021 AGAAGCCGCC CAGCTCCCAA ACGGAGGGGA AGAGGAGGCC GGATTTGCCA ACTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1201 GAAAGGACGA TAGTATGCAT TGGACTATTC CCCAACGCGT TAAGTCgaca atcaacctct 1261 ggattacaaa atttgtgaaa gatt