Transcript: Human NM_030615.2

Homo sapiens kinesin family member 25 (KIF25), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
KIF25 (3834)
Length:
1510
CDS:
263..1417

Additional Resources:

NCBI RefSeq record:
NM_030615.2
NBCI Gene record:
KIF25 (3834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108358 CCAGGTCTCACCTGATAATTA pLKO.1 849 CDS 100% 15.000 21.000 N KIF25 n/a
2 TRCN0000437666 ACTGATGGAGCTCGTTCATGG pLKO_005 778 CDS 100% 4.050 5.670 N KIF25 n/a
3 TRCN0000108357 CCATAGTGGAAGTTTACAATA pLKO.1 624 CDS 100% 13.200 9.240 N KIF25 n/a
4 TRCN0000108355 CCAAAGGTTGAAGTCTCCATA pLKO.1 608 CDS 100% 4.950 3.465 N KIF25 n/a
5 TRCN0000421858 TTTGACCTTCTGGCCAAAGAC pLKO_005 653 CDS 100% 4.950 3.465 N KIF25 n/a
6 TRCN0000108356 CGATGCGAAGTTACTGGTGAT pLKO.1 1252 CDS 100% 4.050 2.835 N KIF25 n/a
7 TRCN0000423060 GACTTAGGAATTATCCCTAGA pLKO_005 539 CDS 100% 4.050 2.835 N KIF25 n/a
8 TRCN0000108359 CTACTCACTTCTCTCTTGGAT pLKO.1 407 CDS 100% 3.000 2.100 N KIF25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06497 pDONR223 100% 86.3% 86.4% None 321C>T;829_984del n/a
2 ccsbBroad304_06497 pLX_304 0% 86.3% 86.4% V5 321C>T;829_984del n/a
3 TRCN0000491977 TAGTATGCATTGGACTATTCCCCA pLX_317 15.7% 86.3% 86.4% V5 321C>T;829_984del n/a
Download CSV