Construct: ORF TRCN0000491990
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003127.1_s317c1
- Derived from:
- ccsbBroadEn_01674
- DNA Barcode:
- CAGTGAAATTAGGACTATACCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TIMP4 (7079)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491990
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7079 | TIMP4 | TIMP metallopeptidase inhib... | NM_003256.4 | 100% | 100% | |
2 | mouse | 110595 | Timp4 | tissue inhibitor of metallo... | NM_080639.3 | 87.6% | 88.8% | (many diffs) |
3 | mouse | 110595 | Timp4 | tissue inhibitor of metallo... | XM_017321325.1 | 75% | 60% | (many diffs) |
4 | mouse | 110595 | Timp4 | tissue inhibitor of metallo... | XM_006505367.2 | 57.5% | 59.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 738
- ORF length:
- 672
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgggagccct cggcccgcgc caagctgggt gctgttgctg cggctgctgg 121 cgttgctgcg gcccccgggg ctgggtgagg catgcagctg cgccccggcg caccctcagc 181 agcacatctg ccactcggca cttgtgattc gggccaaaat ctccagtgag aaggtagttc 241 cggccagtgc agaccctgct gacactgaaa aaatgctccg gtatgaaatc aaacagataa 301 agatgttcaa agggtttgag aaagtcaagg atgttcagta tatctatacg ccttttgact 361 cttccctctg tggtgtgaaa ctagaagcca acagccagaa gcagtatctc ttgactggtc 421 aggTCCTCAG TGATGGAAAA GTCTTCATCC ATCTGTGCAA CTACATCGAG CCCTGGGAGG 481 ACCTGTCCTT GGTGCAGAGG GAAAGTCTGA ATCATCACTA CCATCTGAAC TGTGGCTGCC 541 AAATCACCAC CTGCTACACA GTACCCTGTA CCATCTCGGC CCCTAACGAG TGCCTCTGGA 601 CAGACTGGCT GTTGGAACGA AAGCTCTATG GTTACCAGGC TCAGCATTAT GTCTGTATGA 661 AGCATGTTGA CGGCACCTGC AGCTGGTACC GGGGCCACCT GCCTCTCAGG AAGGAGTTTG 721 TTGACATCGT TCAGCCCTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 781 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGCCCG TAACTTGAAA 841 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACAGTGAA ATTAGGACTA 901 TACCTATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt