Construct: ORF TRCN0000492003
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019225.2_s317c1
- DNA Barcode:
- TCCAAATTGCACGTCTGAAATGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TAS2R45 (259291)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492003
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 259291 | TAS2R45 | taste 2 receptor member 45 | NM_176886.2 | 99.4% | 98.3% | (many diffs) |
| 2 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | XM_003960991.5 | 99.4% | 98.3% | (many diffs) |
| 3 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | NM_176884.2 | 89.7% | 83.8% | (many diffs) |
| 4 | human | 259290 | TAS2R31 | taste 2 receptor member 31 | NM_176885.2 | 89.4% | 81.8% | (many diffs) |
| 5 | human | 259292 | TAS2R46 | taste 2 receptor member 46 | NM_176887.2 | 89.2% | 82.8% | (many diffs) |
| 6 | human | 259293 | TAS2R30 | taste 2 receptor member 30 | NM_001097643.1 | 85.6% | 76.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 972
- ORF length:
- 897
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgata acttttctgc ccatcatatt ttccattcta gtagtggtta 121 catttgttat tggaaatttt gctaatggct tcatagcgtt ggtaaattcc accgagtggg 181 tgaagagaca aaagatctcc tttgctgacc aaattgtcac tgctctggcg gtctccagag 241 ttggtttgct ctgggtgtta ttattaaatt ggtattcaac tgtgttgaat ccagcttttt 301 gtagtgtaga attaagaact actgcttata atatctgggc agtaaccggc catttcagca 361 actggcctgc tactagcctc agcatatttt atttgctcaa gattgccaat ttctccaacc 421 ttatttttct tcgcttaaag aggagagtta agagtgtcat tctggtgatg ctgttggggc 481 ctttgctatt tttggcttgt catctttttg tggtaaacat gaatcagatt gtatggacaa 541 aagaatatga aggaaacatg acttggaaga tcaaattgag gcgtgcaatg taCCTTTCAG 601 ATACGACTGT AACCATGCTA GCAAACTTAG TACCCTTTAC TGTAACCCTG ATATCTTTTC 661 TGCTGTTAGT CTGTTCTCTG TGTAAACATC TCAAGAAGAT GCACCTCCAT GGCAAAGGAT 721 CTCAAGATCC CAGTACCAAG GTCCACATAA AAGTTTTGCA AACTGTGATC TCCTTCCTCT 781 TGTTATGTGC CATTTACTTT GTGTCTGTAA TAATATCAGT TTGGAGTTTT AAGAATCTGG 841 AAAACAAACC TGTCTTCATG TTCTGCCAAG CTATTGGATT CAGCTGTTCT TCAGCCCACC 901 CGTTCATCCT GATTTGGGGA AACAAGAAGC TAAAGCAGAC TTATCTTTCA GTTTTGTGGC 961 AAATGAGGTA CGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCC AAATTGCACG TCTGAAATGT 1141 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t