Construct: ORF TRCN0000492031
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021241.2_s317c1
- DNA Barcode:
- TCCAAGTATGCTAAGTGAAAAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DYRK2 (8445)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492031
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8445 | DYRK2 | dual specificity tyrosine p... | NM_003583.4 | 99.8% | 100% | 708T>C;1272G>T |
| 2 | human | 8445 | DYRK2 | dual specificity tyrosine p... | XM_017020032.1 | 99.8% | 100% | 708T>C;1272G>T |
| 3 | human | 8445 | DYRK2 | dual specificity tyrosine p... | NM_006482.3 | 87.7% | 87.8% | 1_219del;927T>C;1491G>T |
| 4 | mouse | 69181 | Dyrk2 | dual-specificity tyrosine-(... | XM_011243552.2 | 89.9% | 97.9% | (many diffs) |
| 5 | mouse | 69181 | Dyrk2 | dual-specificity tyrosine-(... | NM_001014390.2 | 79% | 86% | (many diffs) |
| 6 | mouse | 69181 | Dyrk2 | dual-specificity tyrosine-(... | XM_006514046.3 | 71.2% | 77.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 59
- ORF end:
- 1643
- ORF length:
- 1584
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaccat 61 gaatgatcac ctgcatgtcg gcagccacgc tcacggacag atccaggttc aacagttgtt 121 tgaggataac agtaacaagc ggacagtgct cacgacacaa ccaaatgggc ttacaacagt 181 gggcaaaacg ggcttgccag tggtgccaga gcggcagctg gacagcattc atagacggca 241 ggggagctcc acctctctaa agtccatgga aggcatgggg aaggtgaaag ccacccccat 301 gacacctgaa caagcaatga agcaatacat gcaaaaactc acagccttcg aacaccatga 361 gattttcagc taccctgaaa tatatttctt gggtctaaat gctaagaagc gccagggcat 421 gacaggtggg cccaacaatg gtggctatga tgatgaccag ggatcatatg tgcaggtgcc 481 ccacgatcac gtggcttaca ggtatgaggt cctcaaggtc attgggaagg ggagctttgg 541 gcaggtggtc aaggcctacg atcacaaagt ccaccagcac gtggccctaa agatggtgcg 601 gaatgagaag cgcttccacc ggcaagcagc ggaggagatc cgaatcctgg aacacctgcg 661 gaagcaggac aaggataaca caatgaatgt catccatatg ctggagaatt tcaccttccg 721 caaccacatc tgcatgacgt ttgagctgct gagcatgaac ctctacgagc tcatcaagaa 781 gaataaattc cagggcttca gtctgccttt ggttcgcaag tttgcccact cgattctgca 841 gtgcttggat gctttgcaca aaaacagaat aattcactgt gaccttaagc ccgagaacat 901 tttgttaaag cagcagggta gaagcggtat taaagtaatt gattttggct ccagttgtta 961 cgagcatcag cgtgtctaca cgtacatcca gtcgcgtttt taccgggctc cagaagtgat 1021 ccttggggcc aggtatggca tgcccattga tatgtggagc ctgggctgca ttttagcaga 1081 gctcctgacg ggttaccccc tcttgcctgg ggaagatgaa ggggaccagc tggcctgtat 1141 gattgaactg ttgggcatgc cctcacagaa actgctggat gcatccaaac gagccaaaaa 1201 ttttgtgagc tccaagggtt atccccgtta ctgcactgtc acgactctct cagatggctc 1261 tgtggtccTA AACGGAGGCC GTTCCCGGAG GGGGAAACTG AGGGGCCCAC CGGAGAGCAG 1321 AGAGTGGGGT AACGCGCTGA AGGGGTGTGA TGATCCCCTT TTCCTTGACT TCTTAAAACA 1381 GTGTTTAGAG TGGGATCCTG CAGTGCGCAT GACCCCAGGC CAGGCTTTGC GGCACCCCTG 1441 GCTGAGGAGG CGGTTGCCAA AGCCTCCCAC CGGGGAGAAA ACGTCAGTGA AAAGGATAAC 1501 TGAGAGCACC GGTGCTATCA CATCTATATC CAAGTTACCT CCACCTTCTA GCTCAGCTTC 1561 CAAACTGAGG ACTAATTTGG CGCAGATGAC AGATGCCAAT GGGAATATTC AGCAGAGGAC 1621 AGTGTTGCCA AAACTTGTTA GCGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 1681 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 1741 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATC CAAGTATGCT 1801 AAGTGAAAAA TTACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 1861 tt