Transcript: Human NM_006482.3

Homo sapiens dual specificity tyrosine phosphorylation regulated kinase 2 (DYRK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DYRK2 (8445)
Length:
8888
CDS:
390..2195

Additional Resources:

NCBI RefSeq record:
NM_006482.3
NBCI Gene record:
DYRK2 (8445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147259 CAAGCACTGCAGAATCGAGT pXPR_003 GGG 991 55% 3 1.1142 DYRK2 DYRK2 77536
2 BRDN0001147464 TTGAGGATAACAGTAACAAG pXPR_003 CGG 297 16% 3 0.338 DYRK2 DYRK2 77535
3 BRDN0001149160 ACAGCATTCATAGACGGCAG pXPR_003 GGG 399 22% 3 0.144 DYRK2 DYRK2 77537
4 BRDN0001149060 CTAAATGCTAAGAAGCGCCA pXPR_003 GGG 572 32% 3 0.074 DYRK2 DYRK2 77538
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194981 CCAGTTAGCATTCTGACATTC pLKO.1 2787 3UTR 100% 10.800 15.120 N DYRK2 n/a
2 TRCN0000079146 GCCTTCGAACACCATGAGATT pLKO.1 894 CDS 100% 4.950 6.930 N Dyrk2 n/a
3 TRCN0000000652 GAGGACTAATTTGGCGCAGAT pLKO.1 2117 CDS 100% 4.050 5.670 N DYRK2 n/a
4 TRCN0000000651 GCAGGGTAGAAGCGGTATTAA pLKO.1 1463 CDS 100% 15.000 10.500 N DYRK2 n/a
5 TRCN0000000650 CCTGGGAAACTATCAACTCTT pLKO.1 3242 3UTR 100% 4.950 3.465 N DYRK2 n/a
6 TRCN0000000654 CTGAACAAGCAATGAAGCAAT pLKO.1 856 CDS 100% 4.950 3.465 N DYRK2 n/a
7 TRCN0000000653 GCAGGACAAGGATAACACAAT pLKO.1 1214 CDS 100% 4.950 3.465 N DYRK2 n/a
8 TRCN0000079147 GTGCTTGGATGCTTTGCACAA pLKO.1 1391 CDS 100% 4.050 2.835 N Dyrk2 n/a
9 TRCN0000219644 GTATGGCATGCCCATTGATAT pLKO.1 1583 CDS 100% 13.200 7.920 N DYRK2 n/a
10 TRCN0000196792 GCTGTGATTATGACCATTGTT pLKO.1 3094 3UTR 100% 5.625 3.375 N DYRK2 n/a
11 TRCN0000195623 CCAAGTTACCTCCACCTTCTA pLKO.1 2080 CDS 100% 4.950 2.970 N DYRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01929 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01929 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470848 ACAAACGGTCTTTGCTTCCTTTTA pLX_317 12.3% 100% 100% V5 n/a
4 ccsbBroadEn_14895 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14895 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000469113 GCGGACTACCCCTTTGGCTACCTC pLX_317 19.8% 100% 100% V5 n/a
7 TRCN0000489007 AAGCCGATGGAAGGTTAATACAGT pLX_317 21.1% 100% 100% V5 (not translated due to prior stop codon) n/a
8 TRCN0000489170 TTCATTGCATATTCACCCCTCGTT pLX_317 20.9% 99.9% 100% V5 1491G>T n/a
9 TRCN0000489877 GAGAAGCACCTAGCGAGCATATCT pLX_317 20.8% 99.4% 100% V5 (not translated due to prior stop codon) 1491G>T;1803_1804insTGAAAGCTT n/a
10 ccsbBroadEn_15632 pDONR223 0% 87.7% 87.8% None 1_219del;1491G>T n/a
11 ccsbBroad304_15632 pLX_304 0% 87.7% 87.8% V5 1_219del;1491G>T n/a
12 TRCN0000473195 ACCAAGGGCCACGGTAGCTGATTC pLX_317 24% 87.7% 87.6% V5 1_219del;1491G>T;1788G>C n/a
13 TRCN0000492031 TCCAAGTATGCTAAGTGAAAAATT pLX_317 24.1% 87.7% 87.8% V5 1_219del;927T>C;1491G>T n/a
14 TRCN0000487808 GAGGACCGAGACAAGATTCCCTTA pLX_317 18.9% 87.6% 87.8% V5 (not translated due to prior stop codon) 1_219del;1491G>T;1803_1804insTGAG n/a
Download CSV