Construct: ORF TRCN0000492039
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020434.2_s317c1
- DNA Barcode:
- GATCCAATAGAATTTCCAAGTTCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GSK3A (2931)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492039
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2931 | GSK3A | glycogen synthase kinase 3 ... | NM_019884.3 | 100% | 100% | |
| 2 | human | 2931 | GSK3A | glycogen synthase kinase 3 ... | XR_001753673.1 | 54.9% | 1_865del;2315_2638del | |
| 3 | mouse | 606496 | Gsk3a | glycogen synthase kinase 3 ... | NM_001031667.1 | 89% | 93.8% | (many diffs) |
| 4 | mouse | 606496 | Gsk3a | glycogen synthase kinase 3 ... | XM_006540258.1 | 83.7% | 87.4% | (many diffs) |
| 5 | mouse | 606496 | Gsk3a | glycogen synthase kinase 3 ... | XM_006540259.3 | 77.2% | 81% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1521
- ORF length:
- 1449
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgagcggc ggcgggcctt cgggaggcgg ccctgggggc tcgggcaggg 121 cgcggactag ctcgttcgcg gagcccggcg gcggaggcgg aggaggcggc ggcggccccg 181 gaggctcggc ctccggccca ggcggcaccg gcggcggaaa ggcatctgtc ggggccatgg 241 gtgggggcgt cggggcctcg agctccgggg gtggacccgg cggcagcggc ggaggaggca 301 gcggaggccc cggcgcaggc actagcttcc cgccgcccgg ggtgaagctg ggccgtgaca 361 gcgggaaggt gaccacagtc gtagccactc taggccaagg cccagagcgc tcccaagaag 421 tggcttacac ggacatcaaa gtgattggca atggctcatt tggggtcgtg taccaggcac 481 ggctggcaga gaccagggaa ctagtcgcca tcaagaaggt tctccaggac aagaggttca 541 agaaccgaga gctgcagatc atgcgtaagc tggaccactg caatattgtg aggctgagat 601 actttttcta ctccagtggc gagaagaaag acgagcttta cctaaatctg gtgctggaat 661 atgtgcccga gacagtgtac cgggtggccc gccacttcac caaggccaag ttgaccatcc 721 ctatcctcta tgtcaaggtg tacatgtacc agctcttccg cagcttggcc tacatccact 781 cccagggcgt gtgtcaccgc gacatcaagc cccagaacct gctggtggac cctgacactg 841 ctgtcctcaa gctctgcgat tttggcagtg caaagcagtt ggtccgaggg gagcccaatg 901 tctcctacat ctgttctcgc tactaccggg ccccagagct catctttgga gccactgatt 961 acacctcatc catcgatgtt tggtcagctg gctgtgtact ggcagagctc ctcttgggcc 1021 agcccatctt ccctggggac agtggggtgg accagctggt ggagatcatc aaggtgctgg 1081 gaacaccaac ccgggaaCAA ATCCGAGAGA TGAACCCCAA CTACACGGAG TTCAAGTTCC 1141 CTCAGATTAA AGCTCACCCC TGGACAAAGG TGTTCAAATC TCGAACGCCG CCAGAGGCCA 1201 TCGCGCTCTG CTCTAGCCTG CTGGAGTACA CCCCATCCTC AAGGCTCTCC CCACTAGAGG 1261 CCTGTGCGCA CAGCTTCTTT GATGAACTGC GATGTCTGGG AACCCAGCTG CCTAACAACC 1321 GCCCACTTCC CCCTCTCTTC AACTTCAGTG CTGGTGAACT CTCCATCCAA CCGTCTCTCA 1381 ACGCCATTCT CATCCCTCCT CACTTGAGGT CCCCAGCGGG CACTACCACC CTCACCCCGT 1441 CCTCACAAGC TTTAACTGAG ACTCCGACCA GCTCAGACTG GCAGTCGACC GATGCCACAC 1501 CTACCCTCAC TAACTCCTCC TAGGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1561 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1621 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG ATCCAATAGA 1681 ATTTCCAAGT TCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1741 att