Construct: ORF TRCN0000492091
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020934.2_s317c1
- DNA Barcode:
- ACAGGCACTACGGCCCTACTAGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CNR2 (1269)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492091
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1269 | CNR2 | cannabinoid receptor 2 | NM_001841.3 | 99.9% | 99.7% | 946C>T |
| 2 | human | 1269 | CNR2 | cannabinoid receptor 2 | XM_011540629.3 | 99.9% | 99.7% | 946C>T |
| 3 | human | 1269 | CNR2 | cannabinoid receptor 2 | XM_017000261.2 | 99.9% | 99.7% | 946C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1152
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaggaa tgctgggtga cagagatagc caatggctcc aaggatggct 121 tggattccaa ccctatgaag gattacatga tcctgagtgg tccccagaag acagctgttg 181 ctgtgttgtg cactcttctg ggcctgctaa gtgccctgga gaacgtggct gtgctctatc 241 tgatcctgtc ctcccaccaa ctccgccgga agccctcata cctgttcatt ggcagcttgg 301 ctggggctga cttcctggcc agtgtggtct ttgcatgcag ctttgtgaat ttccatgttt 361 tccatggtgt ggattccaag gctgtcttcc tgctgaagat tggcagcgtg actatgacct 421 tcacagcctc tgtgggtagc ctcctgctga ccgccattga ccgatacctc tgcctgcgct 481 atccaccttc ctacaaagct ctgctcaccc gtggaagggc actggtgacc ctgggcatca 541 tgtgggtcct ctcagcacta gtctcctacc tgcccctcat gggatggact tgctgtccca 601 ggccctgctc tgagcttttc ccactgatcc ccaatgacta cctgctgagc tggctcctgt 661 tcatcgcctt cctcttttcc ggaatcatct acacctatgg gcatgttctc tggaaggccc 721 atcagcatgt ggccagcttg tctggccacc aggacaggca ggtgccagga atggcccgaa 781 tgaggctgga tgtgaggttg gccaagaccc tagggctagt gttggctgtg ctcctcatct 841 gttggttccc agtgctggcc cTCATGGCCC ACAGCCTGGC CACTACGCTC AGTGACCAGG 901 TCAAGAAGGC CTTTGCTTTC TGCTCCATGC TGTGCCTCAT CAACTCCATG GTCAACCCTG 961 TCATCTATGC TCTACGGAGT GGAGAGATCC GCTCCTCTGC CCATCACTGC CTGGCTTACT 1021 GGAAGAAGTG TGTGAGGGGC CTTGGGTCAG AGGCAAAAGA AGAAGCCCCG AGATCCTCAG 1081 TCACCGAGAC AGAGGCTGAT GGGAAAATCA CTCCGTGGCC AGATTCCAGA GATCTAGACC 1141 TCTCTGATTG CTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ACAGGCACTA CGGCCCTACT 1321 AGAAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt