Transcript: Human XM_017000261.2

PREDICTED: Homo sapiens cannabinoid receptor 2 (CNR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNR2 (1269)
Length:
3645
CDS:
1103..2185

Additional Resources:

NCBI RefSeq record:
XM_017000261.2
NBCI Gene record:
CNR2 (1269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356850 TGAGGCCTCTTCCCAATTTAA pLKO_005 2186 CDS 100% 15.000 12.000 N CNR2 n/a
2 TRCN0000011288 TCCGGAATCATCTACACCTAT pLKO.1 1709 CDS 100% 4.950 3.960 N CNR2 n/a
3 TRCN0000356852 GCATGCAGCTTTGTGAATTTC pLKO_005 1364 CDS 100% 13.200 9.240 N CNR2 n/a
4 TRCN0000356914 TGGCACTCTCTTCTTACTTAA pLKO_005 2257 3UTR 100% 13.200 9.240 N CNR2 n/a
5 TRCN0000356915 GCTATCCACCTTCCTACAAAG pLKO_005 1509 CDS 100% 10.800 7.560 N CNR2 n/a
6 TRCN0000011285 CTTGGATTCCAACCCTATGAA pLKO.1 1150 CDS 100% 5.625 3.938 N CNR2 n/a
7 TRCN0000011284 CCAGGTCTTCTCTCTGCCTAA pLKO.1 2592 3UTR 100% 4.050 2.835 N CNR2 n/a
8 TRCN0000011286 CCTCATCAACTCCATGGTCAA pLKO.1 1966 CDS 100% 4.050 2.835 N CNR2 n/a
9 TRCN0000011287 TGCAGCTTTGTGAATTTCCAT pLKO.1 1367 CDS 100% 3.000 2.100 N CNR2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3205 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 10 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 10 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492091 ACAGGCACTACGGCCCTACTAGAA pLX_317 27.4% 99.9% 99.7% V5 (not translated due to prior stop codon) 946C>T n/a
2 TRCN0000488729 CATTGTTCTAACATACGATATACT pLX_317 30.9% 99.8% 99.4% V5 946C>T;1080_1081insG n/a
Download CSV