Construct: ORF TRCN0000492236
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021244.2_s317c1
- DNA Barcode:
- TATGTGAAGTACACATGGCCCGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CIDEC (63924)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492236
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199552.2 | 99.8% | 100% | 33C>G |
| 2 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321142.2 | 99.8% | 100% | 33C>G |
| 3 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_022094.3 | 99.8% | 100% | 33C>G |
| 4 | human | 63924 | CIDEC | cell death inducing DFFA li... | XM_024453700.1 | 99.8% | 100% | 33C>G |
| 5 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199551.1 | 95.8% | 95.9% | 33C>G;206_235del |
| 6 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199623.1 | 94.6% | 94.8% | 1_39del;72C>G |
| 7 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321143.2 | 68.9% | 68.9% | 0_1ins222 |
| 8 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321144.2 | 68.9% | 68.9% | 0_1ins222 |
| 9 | human | 152302 | CIDECP1 | cell death inducing DFFA li... | NR_002786.1 | 37.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 786
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaatac gccatgaagt cccttagcct tctgtacccc aagtccctct 121 ccaggcatgt gtcagtgcgt acctctgtgg tgacccagca gctgctgtcg gagcccagcc 181 ccaaggcccc cagggcccgg ccctgccgcg taagcacggc ggatcgaagc gtgaggaagg 241 gcatcatggc ttacagtctt gaggacctcc tcctcaaggt ccgggacact ctgatgctgg 301 cagacaagcc cttcttcctg gtgctggagg aagatggcac aactgtagag acagaagagt 361 acttccaagc cctggcaggg gatacagtgt tcatggtccT CCAGAAGGGG CAGAAATGGC 421 AGCCCCCATC AGAACAGGGG ACAAGGCACC CACTGTCCCT CTCCCATAAG CCTGCCAAGA 481 AGATTGATGT GGCCCGTGTA ACGTTTGATC TGTACAAGCT GAACCCACAG GACTTCATTG 541 GCTGCCTGAA CGTGAAGGCG ACTTTTTATG ATACATACTC CCTTTCCTAT GATCTGCACT 601 GCTGTGGGGC CAAGCGCATC ATGAAGGAAG CTTTCCGCTG GGCCCTCTTC AGCATGCAGG 661 CCACAGGCCA CGTACTGCTT GGCACCTCCT GTTACCTGCA GCAGCTCCTC GATGCTACGG 721 AGGAAGGGCA GCCCCCCAAG GGCAAGGCCT CATCCCTTAT CCCGACCTGT CTGAAGATAC 781 TGCAGTAGAA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 841 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 901 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATATGTG AAGTACACAT GGCCCGTCAC 961 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt