Gene: Human LOC113386 (113386)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 human 113386 LOC113386 TRCN0000141753 GTAGTGTCCTGTGCGTCTATA pLKO.1 NM_138781.2 481 CDS 13.200 n/a
2 human 113386 LOC113386 TRCN0000143800 GCAACCACTAATCCACGTTAT pLKO.1 NM_138781.2 1124 3UTR 10.800 n/a
3 human 113386 LOC113386 TRCN0000140972 CCAGCGGAATCTGAATGCAAA pLKO.1 NM_138781.2 312 CDS 4.950 n/a
4 human 113386 LOC113386 TRCN0000143505 GCACAGCCTGAAATTACCTTT pLKO.1 NM_138781.2 537 3UTR 4.950 n/a
5 human 113386 LOC113386 TRCN0000122286 CCATGTTCTTGGCCATGCTAG pLKO.1 NM_138781.1 425 CDS 4.050 n/a
6 human 113386 LOC113386 TRCN0000141701 CCTCCCTATTCACTCTACCTA pLKO.1 NM_138781.2 853 3UTR 3.000 n/a
7 human 113386 LOC113386 TRCN0000145609 CCTTCTTTCAAACAGATCCTT pLKO.1 NM_138781.2 937 3UTR 3.000 n/a
8 human 113386 LOC113386 TRCN0000122370 CGGAGTCACAATGACATCCAA pLKO.1 NM_138781.1 318 CDS 3.000 n/a
9 human 113386 LOC113386 TRCN0000122725 CCATGCTAGCTGTAGTGTCCT pLKO.1 NM_138781.1 437 CDS 2.640 n/a
10 human 113386 LOC113386 TRCN0000141149 CCTTGAGGTTATCCACAGGAA pLKO.1 NM_138781.2 754 3UTR 2.640 n/a
Download CSV

Additional Resources:

NBCI Gene record:
LOC113386 (113386)