Gene: Human LOC651789 (651789)
This gene has been discontinued and we have no replacement information available at this time.
shRNA constructs designed to target this gene
The following shRNA constructs were originally designed to target this discontinued gene.
| Target Taxon[?]The species of the gene this construct was originally designed to target | Target Gene ID | Target Gene Symbol | Clone ID | Target Seq | Vector | Target Transcript | Match Position | Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR. | Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. | Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor. | Addgene[?]Link to this entity's page in the Addgene catalog, if available | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | human | 651789 | LOC651789 | TRCN0000243811 | GGCCACGTCTATCCCAAATTT | pLKO_005 | XM_001719017.1 | 555 | CDS | 15.000 | n/a | |
| 2 | human | 651789 | LOC651789 | TRCN0000243813 | CAGTTTAGGTATGGTGATTTA | pLKO_005 | XM_001719017.1 | 1406 | 3UTR | 13.200 | n/a | |
| 3 | human | 651789 | LOC651789 | TRCN0000243814 | CTAATCCTATGGATGACAATT | pLKO_005 | XM_001719017.1 | 860 | CDS | 13.200 | n/a | |
| 4 | human | 651789 | LOC651789 | TRCN0000243815 | AGTGGCAACTTCCGCCAATTG | pLKO_005 | XM_001719017.1 | 637 | CDS | 10.800 | n/a | |
| 5 | human | 651789 | LOC651789 | TRCN0000243812 | GTAGAACTCCGGTCAAGTAAC | pLKO_005 | XM_001719017.1 | 1042 | CDS | 10.800 | n/a |
Additional Resources:
- NBCI Gene record:
- LOC651789 (651789)