Transcript: Human NM_000052.7

Homo sapiens ATPase copper transporting alpha (ATP7A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ATP7A (538)
Length:
8492
CDS:
165..4667

Additional Resources:

NCBI RefSeq record:
NM_000052.7
NBCI Gene record:
ATP7A (538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000052.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432937 AGTCAAGAGGATTCGGATAAA pLKO_005 4217 CDS 100% 13.200 18.480 N ATP7A n/a
2 TRCN0000043177 CCTCTTGGTATGGATTGTAAT pLKO.1 3020 CDS 100% 13.200 18.480 N ATP7A n/a
3 TRCN0000043174 GCTGTATTAGTAGCAGTTGAT pLKO.1 3801 CDS 100% 4.950 6.930 N ATP7A n/a
4 TRCN0000430375 TATTGATGTAGAACGTCTAAA pLKO_005 911 CDS 100% 13.200 10.560 N ATP7A n/a
5 TRCN0000436070 GCAAGGTGTTCAGCGAATTAA pLKO_005 752 CDS 100% 15.000 10.500 N ATP7A n/a
6 TRCN0000435704 AGCCAAAGTGAACCCTATTAC pLKO_005 2480 CDS 100% 13.200 9.240 N ATP7A n/a
7 TRCN0000436765 GTGTGCCTCCTGCGTACATAA pLKO_005 1886 CDS 100% 13.200 9.240 N ATP7A n/a
8 TRCN0000434639 TGAATGGTGTGCATCACATTA pLKO_005 262 CDS 100% 13.200 9.240 N ATP7A n/a
9 TRCN0000418612 TGGAGAGTGCTGCCAGTTTAA pLKO_005 4675 3UTR 100% 13.200 9.240 N ATP7A n/a
10 TRCN0000426869 TTCTATTTGAGTTGCGTTTAT pLKO_005 4785 3UTR 100% 13.200 9.240 N ATP7A n/a
11 TRCN0000043176 GCTCCCTAAACAGTGTTGTTA pLKO.1 4579 CDS 100% 5.625 3.938 N ATP7A n/a
12 TRCN0000043173 CCATTCATGTACTAGCACTAT pLKO.1 710 CDS 100% 4.950 3.465 N ATP7A n/a
13 TRCN0000433967 TTTGATGCTGTTATCCATAAT pLKO_005 375 CDS 100% 13.200 7.920 N ATP7A n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5925 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5925 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000052.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.