Transcript: Human NM_000130.5

Homo sapiens coagulation factor V (F5), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
F5 (2153)
Length:
9132
CDS:
96..6770

Additional Resources:

NCBI RefSeq record:
NM_000130.5
NBCI Gene record:
F5 (2153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000130.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083577 GCCGAGAATACACCTATGAAT pLKO.1 529 CDS 100% 5.625 7.875 N F5 n/a
2 TRCN0000413733 GACTAAGCACTGGTATCATAT pLKO_005 5830 CDS 100% 13.200 10.560 N F5 n/a
3 TRCN0000419524 ATGGGACAATGCCAGATATAA pLKO_005 811 CDS 100% 15.000 10.500 N F5 n/a
4 TRCN0000429706 ACATCGCCTCTGGGCTAATAG pLKO_005 1636 CDS 100% 13.200 9.240 N F5 n/a
5 TRCN0000083574 GCAGGCTTACATTGACATTAA pLKO.1 1055 CDS 100% 13.200 9.240 N F5 n/a
6 TRCN0000083575 GCTGAAATTCAGGGATGTTAA pLKO.1 2123 CDS 100% 13.200 9.240 N F5 n/a
7 TRCN0000083573 CCCATGAGTTTCACGCCATTA pLKO.1 5500 CDS 100% 10.800 7.560 N F5 n/a
8 TRCN0000083576 CCCACCTATTGTGGCTAGATA pLKO.1 6194 CDS 100% 5.625 3.938 N F5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000130.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.