Transcript: Human NM_000133.4

Homo sapiens coagulation factor IX (F9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
F9 (2158)
Length:
2800
CDS:
27..1412

Additional Resources:

NCBI RefSeq record:
NM_000133.4
NBCI Gene record:
F9 (2158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372160 GCGAAATGTGATTCGAATTAT pLKO_005 905 CDS 100% 15.000 21.000 N F9 n/a
2 TRCN0000006784 CCGGTATGTCAACTGGATTAA pLKO.1 1370 CDS 100% 13.200 18.480 N F9 n/a
3 TRCN0000006785 CTGTGTTGAAACTGGTGTTAA pLKO.1 827 CDS 100% 13.200 10.560 N F9 n/a
4 TRCN0000372158 GCAGTTGCAAGGATGACATTA pLKO_005 343 CDS 100% 13.200 9.240 N F9 n/a
5 TRCN0000372215 GACGAACCCTTAGTGCTAAAC pLKO_005 990 CDS 100% 10.800 7.560 N F9 n/a
6 TRCN0000006783 CCAAGGTTAATTCATTGGAAT pLKO.1 1427 3UTR 100% 4.950 3.465 N F9 n/a
7 TRCN0000006786 CCACAACTACAATGCAGCTAT pLKO.1 932 CDS 100% 4.950 3.465 N F9 n/a
8 TRCN0000006787 CTATGAATGTTGGTGTCCCTT pLKO.1 368 CDS 100% 2.640 1.848 N F9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00531 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00531 pLX_304 0% 100% 100% V5 n/a
Download CSV