Transcript: Human NM_000135.4

Homo sapiens FA complementation group A (FANCA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
FANCA (2175)
Length:
5452
CDS:
33..4400

Additional Resources:

NCBI RefSeq record:
NM_000135.4
NBCI Gene record:
FANCA (2175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000135.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118986 GCTGCTAATGTACAAACGGAT pLKO.1 3254 CDS 100% 2.640 3.696 N FANCA n/a
2 TRCN0000296800 GACTCCCGTGTGGCGTTTATA pLKO_005 1824 CDS 100% 15.000 12.000 N FANCA n/a
3 TRCN0000118983 GCACAGGAAATGAGGATATTA pLKO.1 3064 CDS 100% 15.000 12.000 N FANCA n/a
4 TRCN0000296799 GCTAATCATTCTAGTTCATTT pLKO_005 291 CDS 100% 13.200 10.560 N FANCA n/a
5 TRCN0000296873 CTTATCTCCAGGCCTTATTAA pLKO_005 2609 CDS 100% 15.000 10.500 N FANCA n/a
6 TRCN0000118982 GCCGACCTCAAGGTTTCTATA pLKO.1 1587 CDS 100% 13.200 9.240 N FANCA n/a
7 TRCN0000291183 GCCGACCTCAAGGTTTCTATA pLKO_005 1587 CDS 100% 13.200 9.240 N FANCA n/a
8 TRCN0000118984 GCACTGCACTTTGCGATTCAA pLKO.1 3717 CDS 100% 5.625 3.938 N FANCA n/a
9 TRCN0000118985 CAGAGTTCTTTGTTGCTTGAA pLKO.1 552 CDS 100% 4.950 3.465 N FANCA n/a
10 TRCN0000291182 CAGAGTTCTTTGTTGCTTGAA pLKO_005 552 CDS 100% 4.950 3.465 N FANCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000135.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.