Transcript: Human NM_000138.5

Homo sapiens fibrillin 1 (FBN1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
FBN1 (2200)
Length:
11609
CDS:
317..8932

Additional Resources:

NCBI RefSeq record:
NM_000138.5
NBCI Gene record:
FBN1 (2200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000138.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055897 CCTGGCGGAAATCAGTGTATT pLKO.1 539 CDS 100% 13.200 18.480 N FBN1 n/a
2 TRCN0000286663 CCTGGCGGAAATCAGTGTATT pLKO_005 539 CDS 100% 13.200 18.480 N FBN1 n/a
3 TRCN0000055895 GCTACCATTCAACTCCCGATA pLKO.1 3870 CDS 100% 4.050 5.670 N FBN1 n/a
4 TRCN0000298672 TACCGGTTTACCCGTTGATAT pLKO_005 5596 CDS 100% 0.000 0.000 N FBN1 n/a
5 TRCN0000055896 CCCAAGGGATTTATCTACAAA pLKO.1 2693 CDS 100% 5.625 4.500 N FBN1 n/a
6 TRCN0000286599 CCCAAGGGATTTATCTACAAA pLKO_005 2693 CDS 100% 5.625 4.500 N FBN1 n/a
7 TRCN0000339535 TGTCTGTGGATCACGTTATAA pLKO_005 487 CDS 100% 15.000 10.500 N Fbn1 n/a
8 TRCN0000055893 CCAGACTACATGCAAGTGAAT pLKO.1 5342 CDS 100% 4.950 3.465 N FBN1 n/a
9 TRCN0000055894 CCTGCATTGATAACAATGAAT pLKO.1 7878 CDS 100% 0.563 0.394 N FBN1 n/a
10 TRCN0000286598 CCTGCATTGATAACAATGAAT pLKO_005 7878 CDS 100% 0.563 0.394 N FBN1 n/a
11 TRCN0000294020 TACCTATTTGGTGCTAGTAAA pLKO_005 9340 3UTR 100% 0.000 0.000 N FBN1 n/a
12 TRCN0000101450 CTATGGTAATTCCTGGGAGAA pLKO.1 1491 CDS 100% 4.050 5.670 N Atp6v1h n/a
13 TRCN0000327354 CTATGGTAATTCCTGGGAGAA pLKO_005 1491 CDS 100% 4.050 5.670 N Atp6v1h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000138.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.