Transcript: Human NM_000168.6

Homo sapiens GLI family zinc finger 3 (GLI3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GLI3 (2737)
Length:
8405
CDS:
282..5024

Additional Resources:

NCBI RefSeq record:
NM_000168.6
NBCI Gene record:
GLI3 (2737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000168.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423882 CAAATGGATGGAGCACGTAAA pLKO_005 2597 CDS 100% 10.800 15.120 N GLI3 n/a
2 TRCN0000020508 CGAACAGATGTGAGCGAGAAA pLKO.1 357 CDS 100% 4.950 6.930 N GLI3 n/a
3 TRCN0000020504 CGGAAATCAATAGGAGTTGAA pLKO.1 5052 3UTR 100% 4.950 3.960 N GLI3 n/a
4 TRCN0000429594 AGCAGCTTGTGCACCATATAA pLKO_005 1765 CDS 100% 15.000 10.500 N GLI3 n/a
5 TRCN0000416117 ACAAGAGGTCCAAGATCAAAC pLKO_005 1576 CDS 100% 10.800 7.560 N GLI3 n/a
6 TRCN0000020507 CGAAGGAACAACCCTTGTCAA pLKO.1 1646 CDS 100% 4.950 3.465 N GLI3 n/a
7 TRCN0000020505 GCAGAATTACTCTGGTCAGTT pLKO.1 4589 CDS 100% 4.950 3.465 N GLI3 n/a
8 TRCN0000020506 GCCATCCACATGGAATATCTT pLKO.1 1074 CDS 100% 5.625 3.375 N GLI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000168.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.