Transcript: Human NM_000172.4

Homo sapiens G protein subunit alpha transducin 1 (GNAT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GNAT1 (2779)
Length:
2465
CDS:
117..1169

Additional Resources:

NCBI RefSeq record:
NM_000172.4
NBCI Gene record:
GNAT1 (2779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443228 GCATCATCGAGACGCAGTTCT pLKO_005 652 CDS 100% 4.950 6.930 N GNAT1 n/a
2 TRCN0000036765 CCTCGAGTTTATCGCCATCAT pLKO.1 302 CDS 100% 0.000 0.000 N GNAT1 n/a
3 TRCN0000036768 CGTCTTCTTCGAGAAGATCAA pLKO.1 920 CDS 100% 0.495 0.396 N GNAT1 n/a
4 TRCN0000036767 CGACACGCAGAACGTCAAATT pLKO.1 1085 CDS 100% 13.200 9.240 N GNAT1 n/a
5 TRCN0000438192 CGCGACGTGAAGGAGATCTAT pLKO_005 1044 CDS 100% 5.625 3.938 N GNAT1 n/a
6 TRCN0000036764 CGACATCATCATCAAGGAGAA pLKO.1 1124 CDS 100% 4.050 2.835 N GNAT1 n/a
7 TRCN0000036766 CGTGACCTGCATCATCTTCAT pLKO.1 755 CDS 100% 4.950 2.970 N GNAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00653 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00653 pLX_304 0% 100% 100% V5 n/a
Download CSV