Transcript: Human NM_000175.5

Homo sapiens glucose-6-phosphate isomerase (GPI), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GPI (2821)
Length:
4125
CDS:
72..1748

Additional Resources:

NCBI RefSeq record:
NM_000175.5
NBCI Gene record:
GPI (2821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049152 CGTCTGGTATGTCTCCAACAT pLKO.1 611 CDS 100% 4.950 6.930 N GPI n/a
2 TRCN0000290591 CGTCTGGTATGTCTCCAACAT pLKO_005 611 CDS 100% 4.950 6.930 N GPI n/a
3 TRCN0000049149 GCGGATGTTCAATGGTGAGAA pLKO.1 317 CDS 100% 4.950 6.930 N GPI n/a
4 TRCN0000290649 GCGGATGTTCAATGGTGAGAA pLKO_005 317 CDS 100% 4.950 6.930 N GPI n/a
5 TRCN0000049148 GCTGGGTATCTGGTACATCAA pLKO.1 1037 CDS 100% 4.950 6.930 N GPI n/a
6 TRCN0000290590 GCTGGGTATCTGGTACATCAA pLKO_005 1037 CDS 100% 4.950 6.930 N GPI n/a
7 TRCN0000049150 CGCCATGTATGAGCACAAGAT pLKO.1 1544 CDS 100% 4.950 3.465 N GPI n/a
8 TRCN0000290644 CGCCATGTATGAGCACAAGAT pLKO_005 1544 CDS 100% 4.950 3.465 N GPI n/a
9 TRCN0000049151 CCTGTCTACTAACACAACCAA pLKO.1 806 CDS 100% 3.000 2.100 N GPI n/a
10 TRCN0000290648 CCTGTCTACTAACACAACCAA pLKO_005 806 CDS 100% 3.000 2.100 N GPI n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3190 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3190 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.