Transcript: Human NM_000231.2

Homo sapiens sarcoglycan gamma (SGCG), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SGCG (6445)
Length:
1661
CDS:
156..1031

Additional Resources:

NCBI RefSeq record:
NM_000231.2
NBCI Gene record:
SGCG (6445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083664 CCGTTTCAAGACCTTAGATTA pLKO.1 717 CDS 100% 13.200 18.480 N SGCG n/a
2 TRCN0000429570 GTAGCCTTGCTCAGTACTAAA pLKO_005 1414 3UTR 100% 13.200 18.480 N SGCG n/a
3 TRCN0000414305 AGTTGCCGTGTGGAGTTAATG pLKO_005 1354 3UTR 100% 13.200 10.560 N SGCG n/a
4 TRCN0000422199 GAATTTAGCTCTTACAATTTG pLKO_005 302 CDS 100% 13.200 9.240 N SGCG n/a
5 TRCN0000418629 TACAGATAAACTTCGAGTAAC pLKO_005 638 CDS 100% 10.800 7.560 N SGCG n/a
6 TRCN0000083666 ACCCGTTTCAAGACCTTAGAT pLKO.1 715 CDS 100% 5.625 3.938 N SGCG n/a
7 TRCN0000083667 GCCAGAGAATCAGTATGTCTA pLKO.1 206 CDS 100% 4.950 3.465 N SGCG n/a
8 TRCN0000083663 CCCTTCAGTTTAATGCAAGTA pLKO.1 1489 3UTR 100% 4.950 2.970 N SGCG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.