Transcript: Human NM_000256.3

Homo sapiens myosin binding protein C, cardiac (MYBPC3), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MYBPC3 (4607)
Length:
4217
CDS:
56..3880

Additional Resources:

NCBI RefSeq record:
NM_000256.3
NBCI Gene record:
MYBPC3 (4607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082903 CCTCCCTACTGTTGGATGTAT pLKO.1 3961 3UTR 100% 5.625 4.500 N MYBPC3 n/a
2 TRCN0000082906 AGCCAGAATATGGTTGGCTTT pLKO.1 3476 CDS 100% 0.405 0.324 N MYBPC3 n/a
3 TRCN0000446976 ACCAAGGAGCCCGTCTTTATC pLKO_005 3515 CDS 100% 13.200 9.240 N MYBPC3 n/a
4 TRCN0000082904 GCCAGAATATGGTTGGCTTTA pLKO.1 3477 CDS 100% 10.800 7.560 N MYBPC3 n/a
5 TRCN0000416108 GTTCACCGTCTTGGAGCATTA pLKO_005 3391 CDS 100% 10.800 7.560 N MYBPC3 n/a
6 TRCN0000082905 CAGGGATCTTACGCAGTCATT pLKO.1 281 CDS 100% 4.950 3.465 N MYBPC3 n/a
7 TRCN0000082907 CCACTTCATGGAGGTCAAGAT pLKO.1 1942 CDS 100% 4.950 3.465 N MYBPC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.