Transcript: Human NM_000370.3

Homo sapiens alpha tocopherol transfer protein (TTPA), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
TTPA (7274)
Length:
2633
CDS:
33..869

Additional Resources:

NCBI RefSeq record:
NM_000370.3
NBCI Gene record:
TTPA (7274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427972 CGGATTCATTTCCATTGAAAG pLKO_005 583 CDS 100% 10.800 15.120 N TTPA n/a
2 TRCN0000060086 GCTTATGACGTATTTCGAGTA pLKO.1 417 CDS 100% 4.050 5.670 N TTPA n/a
3 TRCN0000426016 GAGCATTCAATGAGAAGTTAT pLKO_005 857 CDS 100% 13.200 10.560 N TTPA n/a
4 TRCN0000060087 CCCTAGAAGTATTATTGGCCT pLKO.1 296 CDS 100% 0.660 0.528 N TTPA n/a
5 TRCN0000060084 CGTGGCATCCATTTGATAAAT pLKO.1 606 CDS 100% 15.000 10.500 N TTPA n/a
6 TRCN0000435130 TGATATCCAACCTGGTTAAAT pLKO_005 914 3UTR 100% 15.000 10.500 N TTPA n/a
7 TRCN0000431663 GTGAATGGCTTCCTAACTAAA pLKO_005 883 3UTR 100% 13.200 9.240 N TTPA n/a
8 TRCN0000105383 GAAGATTATCTCAGCAGCATT pLKO.1 831 CDS 100% 4.950 3.465 N Ttpa n/a
9 TRCN0000060083 GCCAAGAAGATTGCTGCTGTA pLKO.1 558 CDS 100% 4.050 2.835 N TTPA n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2145 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2145 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2143 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2143 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2143 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2292 3UTR 100% 4.950 2.475 Y SPC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.