Transcript: Human NM_000387.6

Homo sapiens solute carrier family 25 member 20 (SLC25A20), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC25A20 (788)
Length:
1778
CDS:
89..994

Additional Resources:

NCBI RefSeq record:
NM_000387.6
NBCI Gene record:
SLC25A20 (788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000387.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044545 CTGGGAAATATCCTAATGGTT pLKO.1 813 CDS 100% 3.000 4.200 N SLC25A20 n/a
2 TRCN0000044547 GCGGCCTGTTTCCTTGGCTTT pLKO.1 929 CDS 100% 1.350 1.080 N SLC25A20 n/a
3 TRCN0000333563 GCGGCCTGTTTCCTTGGCTTT pLKO_005 929 CDS 100% 1.350 1.080 N SLC25A20 n/a
4 TRCN0000044546 GAACGGATCAAGTGCTTATTA pLKO.1 482 CDS 100% 15.000 10.500 N SLC25A20 n/a
5 TRCN0000307709 GAACGGATCAAGTGCTTATTA pLKO_005 482 CDS 100% 15.000 10.500 N SLC25A20 n/a
6 TRCN0000044544 CCCAGCTAGTGGAATGTATTT pLKO.1 628 CDS 100% 13.200 9.240 N SLC25A20 n/a
7 TRCN0000291448 CCCAGCTAGTGGAATGTATTT pLKO_005 628 CDS 100% 13.200 9.240 N SLC25A20 n/a
8 TRCN0000044543 CCAGAAGATGTGCTCAGCTAT pLKO.1 398 CDS 100% 4.950 3.465 N SLC25A20 n/a
9 TRCN0000307710 CCAGAAGATGTGCTCAGCTAT pLKO_005 398 CDS 100% 4.950 3.465 N SLC25A20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000387.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.