Transcript: Human NM_000450.2

Homo sapiens selectin E (SELE), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SELE (6401)
Length:
3875
CDS:
158..1990

Additional Resources:

NCBI RefSeq record:
NM_000450.2
NBCI Gene record:
SELE (6401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057788 CGAGGCTACATGAATTGTCTT pLKO.1 1280 CDS 100% 4.950 6.930 N SELE n/a
2 TRCN0000435235 CTCTCCCTTGCTCGCTGTAAA pLKO_005 2310 3UTR 100% 13.200 9.240 N SELE n/a
3 TRCN0000057789 CCTCCTGACATTAGCACCATT pLKO.1 1858 CDS 100% 4.950 3.465 N SELE n/a
4 TRCN0000057792 GTGAGCAAATTGTGAACTGTA pLKO.1 678 CDS 100% 4.950 3.465 N SELE n/a
5 TRCN0000057790 GCCAGTGCTTATTGTCAGCAA pLKO.1 263 CDS 100% 2.640 1.848 N SELE n/a
6 TRCN0000057791 GCTGTGACAAATCCAGCCAAT pLKO.1 887 CDS 100% 4.050 2.430 N SELE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01517 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01517 pLX_304 0% 100% 100% V5 n/a
Download CSV