Transcript: Human NM_000477.7

Homo sapiens albumin (ALB), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ALB (213)
Length:
2285
CDS:
42..1871

Additional Resources:

NCBI RefSeq record:
NM_000477.7
NBCI Gene record:
ALB (213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000477.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371292 AGTTGCAACTCTTCGTGAAAC pLKO_005 341 CDS 100% 10.800 15.120 N ALB n/a
2 TRCN0000059426 GCCTTCATTAGCTGCTGATTT pLKO.1 1019 CDS 100% 13.200 10.560 N ALB n/a
3 TRCN0000059425 GCCAGAAGACATCCTTACTTT pLKO.1 540 CDS 100% 5.625 4.500 N ALB n/a
4 TRCN0000371244 CAAGCTGCCTTAGGCTTATAA pLKO_005 1851 CDS 100% 15.000 10.500 N ALB n/a
5 TRCN0000059427 CCCTGTGCAGAAGACTATCTA pLKO.1 1452 CDS 100% 5.625 3.938 N ALB n/a
6 TRCN0000059424 GCTGAAACATTCACCTTCCAT pLKO.1 1623 CDS 100% 3.000 2.100 N ALB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000477.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15353 pDONR223 0% 65% 65% None 489_1127del n/a
2 ccsbBroad304_15353 pLX_304 0% 65% 65% V5 489_1127del n/a
Download CSV