Transcript: Human NM_000492.4

Homo sapiens CF transmembrane conductance regulator (CFTR), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CFTR (1080)
Length:
6070
CDS:
71..4513

Additional Resources:

NCBI RefSeq record:
NM_000492.4
NBCI Gene record:
CFTR (1080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421411 GTGATTCTTTCGACCAATTTA pLKO_005 2010 CDS 100% 15.000 21.000 N CFTR n/a
2 TRCN0000423634 GAAGGTGGAAATGCCATATTA pLKO_005 3731 CDS 100% 15.000 10.500 N CFTR n/a
3 TRCN0000082964 CCTGGAATTGTCAGACATATA pLKO.1 163 CDS 100% 13.200 9.240 N CFTR n/a
4 TRCN0000082966 GTTGGTATTATCCTGACTTTA pLKO.1 3455 CDS 100% 13.200 9.240 N CFTR n/a
5 TRCN0000082963 CCCTTGATGAAGAAGTTGATA pLKO.1 5270 3UTR 100% 5.625 3.938 N CFTR n/a
6 TRCN0000082965 CCCTATGAACAGTGGAGTGAT pLKO.1 3986 CDS 100% 4.950 3.465 N CFTR n/a
7 TRCN0000082967 GCAGTACGATTCCATCCAGAA pLKO.1 4336 CDS 100% 4.050 2.835 N CFTR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.