Transcript: Human NM_000625.4

Homo sapiens nitric oxide synthase 2 (NOS2), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NOS2 (4843)
Length:
4206
CDS:
265..3726

Additional Resources:

NCBI RefSeq record:
NM_000625.4
NBCI Gene record:
NOS2 (4843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000625.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231570 CTACCTCAAGCTATCGAATTT pLKO_005 682 CDS 100% 13.200 18.480 N NOS2 n/a
2 TRCN0000231573 GAAGCGCTATCACGAAGATAT pLKO_005 3624 CDS 100% 13.200 18.480 N NOS2 n/a
3 TRCN0000231572 AGGAGCAGGTCGAGGACTATT pLKO_005 3584 CDS 100% 13.200 9.240 N NOS2 n/a
4 TRCN0000231571 CTGTCGTTGAGATCAACATTG pLKO_005 1505 CDS 100% 10.800 7.560 N NOS2 n/a
5 TRCN0000003763 GAAGCGGTAACAAAGGAGATA pLKO.1 763 CDS 100% 4.950 3.465 N NOS2 n/a
6 TRCN0000003765 GAGACCCAAGAGAAGAGAGAT pLKO.1 1782 CDS 100% 4.950 3.465 N NOS2 n/a
7 TRCN0000003761 CCAGAAGCAGAATGTGACCAT pLKO.1 1542 CDS 100% 2.640 1.848 N NOS2 n/a
8 TRCN0000003762 CGAGGACTATTTCTTTCAGCT pLKO.1 3594 CDS 100% 2.640 1.848 N NOS2 n/a
9 TRCN0000003764 TGTGTATTTAACTGCCTTGTG pLKO.1 4060 3UTR 100% 4.050 2.430 N NOS2 n/a
10 TRCN0000231574 ATGGAGCCAGCTCTGCATTAT pLKO_005 3770 3UTR 100% 13.200 6.600 Y NOS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000625.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.