Transcript: Human NM_000876.3

Homo sapiens insulin like growth factor 2 receptor (IGF2R), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
IGF2R (3482)
Length:
14058
CDS:
149..7624

Additional Resources:

NCBI RefSeq record:
NM_000876.3
NBCI Gene record:
IGF2R (3482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416745 AGCGGAGGTTCATCCTATATT pLKO_005 1187 CDS 100% 15.000 21.000 N IGF2R n/a
2 TRCN0000436433 ATACGTTGATGGCGACTTATG pLKO_005 4510 CDS 100% 10.800 15.120 N IGF2R n/a
3 TRCN0000435526 CAAGCACCTCCAACCAAATAA pLKO_005 7666 3UTR 100% 15.000 12.000 N IGF2R n/a
4 TRCN0000060256 CGCTGGCGAATACACTTATTA pLKO.1 3901 CDS 100% 15.000 12.000 N IGF2R n/a
5 TRCN0000060257 CCGGACATCCAGCATCATATT pLKO.1 5992 CDS 100% 13.200 10.560 N IGF2R n/a
6 TRCN0000119862 CGACCTATAAGAAGCCTTAAT pLKO.1 8609 3UTR 100% 13.200 10.560 N Igf2r n/a
7 TRCN0000287512 CGACCTATAAGAAGCCTTAAT pLKO_005 8609 3UTR 100% 13.200 10.560 N Igf2r n/a
8 TRCN0000060254 CCTGCATTCAAGAGGTTTGAT pLKO.1 6455 CDS 100% 5.625 4.500 N IGF2R n/a
9 TRCN0000060255 CCTGCAAGAAAGACATATTTA pLKO.1 627 CDS 100% 15.000 10.500 N IGF2R n/a
10 TRCN0000437190 GCTACGAGGAGTGCATCATAG pLKO_005 5886 CDS 100% 10.800 7.560 N IGF2R n/a
11 TRCN0000060253 GCTATGAAATTGAGTGGATTA pLKO.1 1068 CDS 100% 10.800 7.560 N IGF2R n/a
12 TRCN0000119864 GCCTGCAAGAAAGACATATTT pLKO.1 626 CDS 100% 15.000 9.000 N Igf2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.