Transcript: Human NM_000972.3

Homo sapiens ribosomal protein L7a (RPL7A), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
RPL7A (6130)
Length:
887
CDS:
27..827

Additional Resources:

NCBI RefSeq record:
NM_000972.3
NBCI Gene record:
RPL7A (6130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218188 CTATCAGGACCAATTACAATG pLKO_005 688 CDS 100% 10.800 15.120 N RPL7AP66 n/a
2 TRCN0000230983 TGAAAGTGCCTCCTGCGATTA pLKO_005 247 CDS 100% 10.800 7.560 N RPL7AP66 n/a
3 TRCN0000156926 GAAGAAGCAGGAGGCTAAGAA pLKO.1 83 CDS 100% 5.625 3.938 N RPL7A n/a
4 TRCN0000157381 CAGGTGAACTCGGAAGACAAA pLKO.1 642 CDS 100% 4.950 3.465 N RPL7A n/a
5 TRCN0000157678 CATCGAGCTGGTTGTCTTCTT pLKO.1 515 CDS 100% 4.950 3.465 N RPL7A n/a
6 TRCN0000155029 GAGGCTAAGAAAGTGGTGAAT pLKO.1 93 CDS 100% 4.950 3.465 N RPL7A n/a
7 TRCN0000157644 GTGGAAGCTATCAGGACCAAT pLKO.1 681 CDS 100% 4.950 3.465 N RPL7A n/a
8 TRCN0000155473 GCATTATCAAGGGAAAGGCAA pLKO.1 571 CDS 100% 2.640 1.848 N RPL7A n/a
9 TRCN0000155839 CCTTACTGCATTATCAAGGGA pLKO.1 564 CDS 100% 0.750 0.525 N RPL7A n/a
10 TRCN0000157881 CAAACAGCTACTCAGCTGCTT pLKO.1 294 CDS 100% 0.264 0.185 N RPL7A n/a
11 TRCN0000156783 GCAAGAGAAGAAGCAGAGACT pLKO.1 347 CDS 100% 2.640 1.584 N RPL7A n/a
12 TRCN0000156821 GCAGAGAGCCATCCTCTATAA pLKO.1 221 CDS 100% 13.200 6.600 Y RPL7A n/a
13 TRCN0000217089 CTAAGCTGGTGGAAGCTATTA pLKO.1 673 CDS 100% 13.200 18.480 N Rpl7a n/a
14 TRCN0000194463 GCTACTCAGCTGCTTAAGCTT pLKO.1 300 CDS 100% 3.000 2.400 N Rpl7a n/a
15 TRCN0000230984 TCCTTCGAGCAGGAGTTAATA pLKO_005 430 CDS 100% 15.000 10.500 N RPL7AP66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.