Transcript: Mouse NM_001001183.1

Mus musculus transmembrane protein 204 (Tmem204), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem204 (407831)
Length:
1865
CDS:
572..1252

Additional Resources:

NCBI RefSeq record:
NM_001001183.1
NBCI Gene record:
Tmem204 (407831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253971 TGAGTCCGGGCTACCTATATA pLKO_005 1353 3UTR 100% 15.000 21.000 N Tmem204 n/a
2 TRCN0000253970 TTTCGCCGTGGCTTAGATAAT pLKO_005 1208 CDS 100% 13.200 18.480 N Tmem204 n/a
3 TRCN0000265433 ATGCTGAGAGCACCCTTATAG pLKO_005 1246 CDS 100% 13.200 9.240 N Tmem204 n/a
4 TRCN0000253972 TTGGCCCTTACACCAACTTAT pLKO_005 1047 CDS 100% 13.200 9.240 N Tmem204 n/a
5 TRCN0000253973 CAATGCTCATCTGGAACATTC pLKO_005 1122 CDS 100% 10.800 7.560 N Tmem204 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04100 pDONR223 100% 83.5% 88% None (many diffs) n/a
2 ccsbBroad304_04100 pLX_304 0% 83.5% 88% V5 (many diffs) n/a
3 TRCN0000472821 GGTTCTGGGCTGCTTCATCACAGA pLX_317 70.4% 83.5% 88% V5 (many diffs) n/a
Download CSV