Transcript: Mouse NM_001001334.2

Mus musculus sperm associated antigen 6 (Spag6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Spag6 (381350)
Length:
1651
CDS:
49..1578

Additional Resources:

NCBI RefSeq record:
NM_001001334.2
NBCI Gene record:
Spag6 (381350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252203 ACTGCAGAATGCGGGTATAAT pLKO_005 156 CDS 100% 15.000 21.000 N Spag6 n/a
2 TRCN0000252202 GCCTGGGCACTTGCATATATT pLKO_005 484 CDS 100% 15.000 10.500 N Spag6 n/a
3 TRCN0000252205 AGAATGCTTGTACTCTGATTA pLKO_005 854 CDS 100% 13.200 9.240 N Spag6 n/a
4 TRCN0000183951 CGACAGCTATCAGCCTCTTAT pLKO.1 1551 CDS 100% 13.200 9.240 N Spag6 n/a
5 TRCN0000252204 TCCATCCTCCAAGAGTATATC pLKO_005 1450 CDS 100% 13.200 9.240 N Spag6 n/a
6 TRCN0000180290 CCTGGATACTCAGACATACTT pLKO.1 1519 CDS 100% 5.625 3.938 N Spag6 n/a
7 TRCN0000180606 GCCAACTACAACGATGACTTA pLKO.1 253 CDS 100% 4.950 3.465 N Spag6 n/a
8 TRCN0000252206 TGTAACAAGTGGTGGACTTAA pLKO_005 1398 CDS 100% 13.200 7.920 N Spag6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.