Transcript: Human NM_001001390.2

Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CD44 (960)
Length:
4684
CDS:
134..1615

Additional Resources:

NCBI RefSeq record:
NM_001001390.2
NBCI Gene record:
CD44 (960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296191 GGACCAATTACCATAACTATT pLKO_005 554 CDS 100% 13.200 18.480 N CD44 n/a
2 TRCN0000308110 CCGTTGGAAACATAACCATTA pLKO_005 1646 3UTR 100% 10.800 15.120 N CD44 n/a
3 TRCN0000057564 CCTCCCAGTATGACACATATT pLKO.1 465 CDS 100% 13.200 10.560 N CD44 n/a
4 TRCN0000289233 CCTCCCAGTATGACACATATT pLKO_005 465 CDS 100% 13.200 10.560 N CD44 n/a
5 TRCN0000296190 ATGGACTCCAGTCATAGTATA pLKO_005 803 CDS 100% 13.200 9.240 N CD44 n/a
6 TRCN0000057563 GCCCTATTAGTGATTTCCAAA pLKO.1 2687 3UTR 100% 4.950 3.465 N CD44 n/a
7 TRCN0000057567 CGCTATGTCCAGAAAGGAGAA pLKO.1 593 CDS 100% 4.050 2.835 N CD44 n/a
8 TRCN0000289308 CGCTATGTCCAGAAAGGAGAA pLKO_005 593 CDS 100% 4.050 2.835 N CD44 n/a
9 TRCN0000057566 CCAACTCTAATGTCAATCGTT pLKO.1 1167 CDS 100% 3.000 2.100 N CD44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05963 pDONR223 100% 70.4% 70.2% None 255C>T;667_668ins618;689T>C n/a
2 ccsbBroad304_05963 pLX_304 0% 70.4% 70.2% V5 255C>T;667_668ins618;689T>C n/a
Download CSV