Transcript: Human NM_001001396.2

Homo sapiens ATPase plasma membrane Ca2+ transporting 4 (ATP2B4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ATP2B4 (493)
Length:
8931
CDS:
898..4410

Additional Resources:

NCBI RefSeq record:
NM_001001396.2
NBCI Gene record:
ATP2B4 (493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005782 CCGGACTATCTGCATAGCTTA pLKO.1 2802 CDS 100% 4.950 3.960 N ATP2B4 n/a
2 TRCN0000005785 CCTGATTCTATACTTTGTGAT pLKO.1 2028 CDS 100% 4.950 3.960 N ATP2B4 n/a
3 TRCN0000273589 GATGCACTGACCCAGATTAAT pLKO_005 1012 CDS 100% 15.000 10.500 N ATP2B4 n/a
4 TRCN0000101866 CCCAAGACTTTCTTAGAATTA pLKO.1 1165 CDS 100% 13.200 9.240 N Atp2b4 n/a
5 TRCN0000273588 GGGCATCCATTACCGTCAAAT pLKO_005 2346 CDS 100% 13.200 9.240 N ATP2B4 n/a
6 TRCN0000005783 GCCAGCACTATACCATTGTTT pLKO.1 3767 CDS 100% 5.625 3.938 N ATP2B4 n/a
7 TRCN0000285012 GCCAGCACTATACCATTGTTT pLKO_005 3767 CDS 100% 5.625 3.938 N ATP2B4 n/a
8 TRCN0000005781 CCCTTGATTTAGTTCCAGAAT pLKO.1 5375 3UTR 100% 4.950 3.465 N ATP2B4 n/a
9 TRCN0000273530 CCCTTGATTTAGTTCCAGAAT pLKO_005 5375 3UTR 100% 4.950 3.465 N ATP2B4 n/a
10 TRCN0000005784 GCTGAGATTGTGGTTGGTGAT pLKO.1 1507 CDS 100% 4.050 2.835 N ATP2B4 n/a
11 TRCN0000273587 GCTGAGATTGTGGTTGGTGAT pLKO_005 1507 CDS 100% 4.050 2.835 N ATP2B4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.